An indirect ELISA kit for detecting antibodies against Haemophilus parasuis
A technology of Haemophilus suis and a kit, which is applied in the field of microbiology and animal infectious disease detection, prevention and control of Haemophilus parasuis disease, and molecular biology. Problems such as low homology of P2 and affecting the versatility of the coating protein have achieved the effects of good versatility, broad application prospects, and high coincidence rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] 1. Cloning, sequencing, expression and purification of Haemophilus parasuis CDT-C protein
[0037] 1.1 Primer design and synthesis
[0038] According to the complete gene sequence of SH0165 (accession number CP001321) H.parasuisCDT-C in GenBank, design a pair of expression primers, P (CDTC-BamHI-F): CGC GGATCC ATGCTAAAGCGTTTTACTTT, under P (CDTC-SalI-R): ACGT GTC GAC The upstream and downstream primers of TTATAATAACCTACTAGGTC introduced BamHI and SalI restriction sites (underlined) respectively to amplify the CDT-COFR sequence. The expected fragment size is 531bp.
[0039] 1.2 Cloning and sequencing analysis of the CDT-C gene of Haemophilus parasuis
[0040] The extracted H.parasuis serum type 1-15 DNA was used as a template, and the primers were P up and P down. The total reaction system is 25 μL, Taq enzyme: 0.25 μL; MgCl2 buffer: 2.5 μL; MgCl2: 2.5 μL; dNTP: 2 μL; F1: 1 μL; R1: 1 μL; ddH2O: 13.75 μL; DNA template 2 μL. The reaction program was: 94°C pre-denatur...
Embodiment 2
[0059] Development of an indirect ELISA kit for detecting antibodies against Haemophilus parasuis
[0060] 1. Expression, extraction, purification and storage of antigens in ELISA antibody detection kit for Haemophilus parasuis
[0061] Inoculate the Escherichia coli production seeds carrying Haemophilus parasuis CDT-C protein in LB liquid medium (containing 100 μg / mL ampicillin sodium), cultivate overnight at 37°C, and transfer to LB liquid medium at a ratio of 1:100 (containing 100 μg / mL ampicillin sodium), shake culture at 37°C until OD 600nm When the value reaches about 0.6, add the final concentration of 0.5mMIPTG to the bacterial liquid, place it in a shaker at 16°C to induce expression for 24 hours, collect the bacterial liquid, freeze and thaw three times at -70°C and 37°C, and then ultrasonically break (300W, Work 5s, interval 10s) 70 times. The collected protein was purified with Octave? Ni-NTASFColumns affinity chromatography column. Purified protein was stored a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com