Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An indirect ELISA kit for detecting antibodies against Haemophilus parasuis

A technology of Haemophilus suis and a kit, which is applied in the field of microbiology and animal infectious disease detection, prevention and control of Haemophilus parasuis disease, and molecular biology. Problems such as low homology of P2 and affecting the versatility of the coating protein have achieved the effects of good versatility, broad application prospects, and high coincidence rate

Active Publication Date: 2016-01-27
SOUTHWEST UNIVERSITY FOR NATIONALITIES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Zhao Qian (2010) showed that the gene sequence of outer membrane protein P5 in the 15 serotypes of H. The middle homology is high and conservation is good, while the homology of the outer membrane protein P2 is low, and some serotype gene sequences have segmental base deletions and multiple point mutations, which may affect its versatility as an envelope protein
Zhang Bin (2013) and others showed that the expressed outer membrane protein P5 protein can react with the positive sera of 15 serotype reference strains of Haemophilus parasuis by immunoblotting. The outer membrane protein P5 protein has good versatility, but indirect ELISA detection The results showed that the ELISA plates expressing the outer membrane protein P5 protein can cross-react with the positive sera of bacteria such as Pasteurella and Actinobacillus pleurodes, and the protein specificity is poor, which may cause false positive results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An indirect ELISA kit for detecting antibodies against Haemophilus parasuis
  • An indirect ELISA kit for detecting antibodies against Haemophilus parasuis
  • An indirect ELISA kit for detecting antibodies against Haemophilus parasuis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Cloning, sequencing, expression and purification of Haemophilus parasuis CDT-C protein

[0037] 1.1 Primer design and synthesis

[0038] According to the complete gene sequence of SH0165 (accession number CP001321) H.parasuisCDT-C in GenBank, design a pair of expression primers, P (CDTC-BamHI-F): CGC GGATCC ATGCTAAAGCGTTTTACTTT, under P (CDTC-SalI-R): ACGT GTC GAC The upstream and downstream primers of TTATAATAACCTACTAGGTC introduced BamHI and SalI restriction sites (underlined) respectively to amplify the CDT-COFR sequence. The expected fragment size is 531bp.

[0039] 1.2 Cloning and sequencing analysis of the CDT-C gene of Haemophilus parasuis

[0040] The extracted H.parasuis serum type 1-15 DNA was used as a template, and the primers were P up and P down. The total reaction system is 25 μL, Taq enzyme: 0.25 μL; MgCl2 buffer: 2.5 μL; MgCl2: 2.5 μL; dNTP: 2 μL; F1: 1 μL; R1: 1 μL; ddH2O: 13.75 μL; DNA template 2 μL. The reaction program was: 94°C pre-denatur...

Embodiment 2

[0059] Development of an indirect ELISA kit for detecting antibodies against Haemophilus parasuis

[0060] 1. Expression, extraction, purification and storage of antigens in ELISA antibody detection kit for Haemophilus parasuis

[0061] Inoculate the Escherichia coli production seeds carrying Haemophilus parasuis CDT-C protein in LB liquid medium (containing 100 μg / mL ampicillin sodium), cultivate overnight at 37°C, and transfer to LB liquid medium at a ratio of 1:100 (containing 100 μg / mL ampicillin sodium), shake culture at 37°C until OD 600nm When the value reaches about 0.6, add the final concentration of 0.5mMIPTG to the bacterial liquid, place it in a shaker at 16°C to induce expression for 24 hours, collect the bacterial liquid, freeze and thaw three times at -70°C and 37°C, and then ultrasonically break (300W, Work 5s, interval 10s) 70 times. The collected protein was purified with Octave? Ni-NTASFColumns affinity chromatography column. Purified protein was stored a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an indirect ELISA (enzyme-linked immuno sorbent assay) kit for detecting a haemophilus parasuis antibody. The kit consists of an ELISA coating plate with haemophilus parasuis cytolethal distending toxin)-C protein serving as a coating antigen, a to-be-detected sample dilution plate, a positive contrast serum, a negative contrast serum, 20-time concentrated washing liquid, a serum sample dilution solution, an enzyme-labeled antibody working solution, a developing solution and a terminating solution. A judgment standard is that if an S / P value is less than 0.200, a sample to be detected is negative; if the S / P value is greater than or equal to 0.200, the to-be-detected sample is positive; the S / P value is obtained according to a formula: S / P value=(the mean value of the to-be-detected sample OD450nm-the mean value of a negative contrast OD450nm) / (the mean value of a positive sample OD450nm-the mean value of the negative contrast OD450nm). Due to the specificity test, the sensitivity test, the repetitiveness test, the coincidence rate test, the test for comparing the kit disclosed by the invention with a kit on sale, the clinical application test and the like, the kit disclosed by the invention has the characteristics of high specificity, high sensitivity, high repetitiveness and the like and is high in coincidence rate to the same type of products on sale home and abroad; the indirect ELISA kit can be used for clinical large-scale detection and epidemiological investigation for the haemophilus parasuis antibodies.

Description

technical field [0001] The invention relates to the technical fields of molecular biology, microbiology and animal infectious disease detection, in particular to an indirect ELISA kit for detecting antibodies to Haemophilus parasuis, and belongs to the field of prevention and control of Haemophilus parasuis disease. Background technique [0002] Haemophilus parasuis disease is an infectious disease caused by Haemophilus parasuis. Haemophilus parasuis ( H. parasuis ) is an NAD-dependent, non-motile, Gram-negative bacillus belonging to the genus Haemophilus of the Pasteurellaceae family. The bacterium is a commensal bacterium in the upper respiratory tract of pigs, which can invade the body under certain conditions and cause a serious systemic disease—Glasser's Disease, which is clinically manifested as multiple serosa in pigs arthritis, arthritis and meningitis. H. parasuis Susceptible to young pigs aged 2 weeks to 4 months, the disease mainly occurs before and after weani...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68
CPCG01N33/56911G01N33/6803G01N2333/285
Inventor 岳华汤承张斌王远微张焕容
Owner SOUTHWEST UNIVERSITY FOR NATIONALITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products