Unlock instant, AI-driven research and patent intelligence for your innovation.

Poria cocos mapk protein coding gene smk1 and its application

A coding and poria technology, applied in application, genetic engineering, plant genetic improvement, etc., to achieve the effect of accelerating growth and increasing yield

Inactive Publication Date: 2016-05-04
朱闻君 +9
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Before the present invention was published, there was no publication or report of the PcWSmk gene and its amino acid sequence mentioned in this patent application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Poria cocos mapk protein coding gene smk1 and its application
  • Poria cocos mapk protein coding gene smk1 and its application
  • Poria cocos mapk protein coding gene smk1 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Poria cocos transcriptome sequencing and data analysis

[0033] 1. Sample collection

[0034] Poriacocos (Schw.) Wolf was obtained from Poriacocos planting bases in Yunnan Province and Dabie Mountains. The sclerotia were immediately frozen in liquid nitrogen and stored in a -80°C refrigerator.

[0035] 2. Isolation and detection of Poria cocos total RNA

[0036] Take 0.1g of Poria cocos (P.cocos) sclerotium sample, quickly grind it into powder with liquid nitrogen in a mortar, quickly transfer it to a 1.5ml centrifuge tube, add 1ml Trizol, mix well, leave it for 10 minutes, centrifuge for 10 minutes, discard Clear; add 200ul chloroform, shake for 15 seconds, let stand for 2-3 minutes; centrifuge at 12,000g for 15 minutes at 4°C, discard 400ul of the supernatant, add 600ul isopropanol, mix lightly and let stand for 10 minutes; centrifuge at 12,000g for 10 minutes at 4°C Discard the supernatant, wash with 1ml 75% ethanol; centrifuge at 7500g for 5 minutes at 4°C; discar...

Embodiment 2

[0042] Cloning of Poria cocos PcWSmk gene

[0043] Analyze the reading frame range of the candidate gene, using the full-length cDNA fragment of Poriacocos (Schw.) Wolf as a template, use forward primer P1: 5'ATGGAAGACCGAGCAGCGGCGACAA3'; reverse primer P2: 5'TCATTGAGGCCGAGGGCGCGTCACT3' to clone the full-length of the candidate gene sequence, linked to the cloning vector TOPOTA vector and transformed into E. coli competent cells E.coliDH5α, the steps are as follows:

[0044] a) Take 100 μL of competent cell suspension from a -80°C ultra-low temperature refrigerator, thaw and place on ice;

[0045] b) Add 5 μL of the ligation product, gently blow and mix with a pipette, and ice-bath for 30 minutes;

[0046] c) Heat shock at 42°C for 90s, then place on ice for 5 minutes;

[0047] d) Add 1 mL of LB liquid medium (without antibiotics) to the EP tube, 37 °C 200 rpm for 45 min;

[0048] e) After shaking the bacteria, take 100 μL of the bacterial solution and spread it on a plate con...

Embodiment 3

[0052] Bioinformatics analysis of Smk1 gene

[0053] The length of the full-length cDNA of the Poria MAPK protein coding gene Smk1 (PcWSmk) involved in the present invention is 1068bp, and its sequence is shown in SEQIDNO.1, wherein the open reading frame is located at 1-1068bp, and the encoded protein sequence is shown in SEQIDNO.2 . The full-length cDNA sequence of Poria cocos was searched for nucleotide homology in Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundantGenBankCDStranslation+PDB+Swissprot+Superdate+PIR databases using BLAST program. The gene has typical MAPK and Protein-Kinase domains. Such as figure 2 and 3 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a poria cocos MAPK (Mitogen Activated Protein Kinase) protein coding gene Smk1 and application thereof. A candidate gene Smk1 of coded MAPK in poria cocos is analyzed and discovered by performing transcriptome sequencing and Denovo splicing on poria cocos by using the second generation of SolexaHiSeq2000, in-vitro cyclone expression is also performed, the obtained gene sequence is as shown in SEQIDNO.1, and the coded protein is SEQIDNO.2. The over-expression of the gene in poria cocos using a transgenic technique shows that the formation of poria cocos sclerotium is accelerated, and the yield of sclerotium is improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and mainly relates to the cloning of the Poria cocos MAPK protein coding gene Smk1 (PcWSmk) by transcriptome data, its coding product and application. Background technique [0002] Medicinal Poria cocos refers to the sclerotia of Poriacocos (Schw.) Wolf, a fungus of the Polyporaceae family. It is one of the popular medicinal materials commonly used in my country. It has extremely high medicinal value and dietary nutritional value. , benefit the spleen and stomach, calm the mind and calm the nerves. Due to the special ecological habits of Poria cocos, the growth and development of its sclerotia mainly depend on the parasitism of pine wood and absorb the carbon source, nitrogen source and other necessary substances. It is of great significance to study the function and mechanism of the genes related to the formation of sclerotium in Poria cocos to improve the conditions of sclerotia formation and incre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/63C12N1/15
CPCC12N9/12C12Y207/11024
Inventor 朱闻君汪琪赵小龙汤进陈平杨涛张绍鹏李长玲邓琛
Owner 朱闻君
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com