Support for antibody purification, manufacturing method for same, and application for same

A technology for immobilizing carriers and antibodies, applied in the field of affinity chromatography columns, which can solve the problems of loss of antibody activity, change of high-level structure of antibodies, and development needs.

Active Publication Date: 2015-05-06
OSAKA SODA CO LTD
View PDF27 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, the above-mentioned method involving elution of antibodies using an acidic buffer solution having a pH of 2.5 to 3.0 has serious drawbacks
Specifically, there is a problem that contact of an antibody with a strong acid (for example, pH 3.0 or less) buffer solution causes acid modification of the antibody and changes the higher order structure of the antibody, leading to induction of aggregation and loss of activity of the antibody as a drug
In order to solve this problem, attempts were made to develop more stable antibody molecules; however, it was apparent that such a solution could not be a conventional solution to the problems accompanying purification by affinity chromatography using a carrier on which protein A was immobilized , and there is a need for the development of methods that can be broadly applied to the preparation of many antibody molecules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Support for antibody purification, manufacturing method for same, and application for same
  • Support for antibody purification, manufacturing method for same, and application for same
  • Support for antibody purification, manufacturing method for same, and application for same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0207] gene synthesis

[0208] The genes described in the examples were synthesized by a contract manufacturer of synthetic genes. dsDNA was synthesized based on the nucleotide sequence (SEQ ID NO: 8) shown below, and inserted into the BamHI-EcoRI site of the pUC18 vector; the sequence of the resulting clone was confirmed by single-strand analysis, and nucleotide sequence Cross-checking of information; mutation correction of sites identified as mismatches by methods such as site-directed mutagenesis; and delivery of resulting obtained plasmid DNA (approximately 1 μg). The sequence of the expected portion of the delivered plasmid was reconfirmed by sequencing.

[0209] Nucleotide sequence of SEQ ID NO:8

[0210] GGATCCTTGACAATATCTTAACTATCTGTTATAATATATTGACCAGGTTAACTAACTAAGCAGCAAAAGGAGGAACGACTATGGCGGATAACAACTTTAACCGCGAACAGCAGAACGCGTTTTATGAAATTCTGAACATGCCGAACCTGAACGAAGAACAGCGCAACGGCTTTATTCAGAGCCTGCGCGATGATCCGAGCCAGAGCGCGAATCTGCTGAGCGAAGCGCGTCGTCTGAATGAAAGCCAGGCGCCGGGCTGTGCGGATGA...

Embodiment 2

[0234] Based on the results of Example 1, other single amino acid substitution mutations were further added to the E15H mutation. As added mutations, the positions M19 (methionine at position 19 in the amino acid sequence shown in SEQ ID NO: 1) and G29 (methionine at position 29 in the amino acid sequence shown in SEQ ID NO: 1) were checked. Substitution mutation at the glycine at the position. This is because M19 is the only methionine residue present in AD-1 and is sensitive to air oxidation, and amino acid substitution at this site is expected to increase antioxidant properties as a chemical property. Position G29 is the position shown as one of the positions whose mutation is expected to improve the elution characteristics at pH 5.0 as a result of the array analysis. For site M19, M19V (replacing methionine with V (valine) at position 19) was selected as the mutation, where T as a parameter for ease of elution at pH 5 0.5 was improved, and for position G29, G29A (substit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An object of the present invention is to provide a carrier on which Protein A has been immobilized, the Protein A having a specific amino acid sequence that permits the desorption of antibodies under mild pH conditions (specifically, pH4.0 to 5.5) in which many antibodies do not undergo acid modification; and a manufacturing method for the carrier. An immobilization carrier (excluding an immobilization carrier having a monolith structure) on which a protein is adsorbed by electrostatic interaction, the protein consisting of an amino acid sequence represented by the general formula: R1-R2-R3-R4-R5-R6, wherein the part represented by R1-R2-R3 is used for immobilization on the immobilization carrier, wherein: the sequence represents a sequence from the amino-terminal side towards the carboxyl-terminal side; the sequence of the R2 part is the sequence of a Protein A mutant as a protein to be immobilized or a sequence in which 1 to 3 units of the sequence thereof were linked together, the Protein A mutant having characteristics of strongly binding to an antibody under neutral conditions and dissociating with the antibody bound under neutral conditions under weakly acidic conditions of pH 4.0 to 5.5.

Description

technical field [0001] The invention relates to a carrier for antibody purification and a preparation method thereof. The present invention further relates to an affinity chromatography column packed with a carrier for antibody purification, and a method for purifying antibodies using the column. Background technique [0002] In recent years, the demand for antibody-based antibody drugs with limited side effects has increased year by year. Affinity chromatography using a carrier on which Protein A (Protein A) is immobilized is widely used as a method for purifying antibodies. Protein A as used herein refers to protein A derived from Staphylococcus aureus (described in A. Forsgren and J. Sjoquist, J. Immunol. (1966) 97, 822-827) or can exhibit the same The function of antibody binding constitutes part of the domain sequence of the protein. [0003] A typical method for purifying antibodies using affinity chromatography using a carrier on which protein A is immobilized is a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K17/00C07K1/22C07K14/31G01N30/88G01N33/53G01N37/00
CPCC07K1/22C07K14/31C07K16/065C07K2317/92B01J20/286B01J20/3204B01J20/3217B01J20/3274B01D15/3809C07K17/14
Inventor岩仓正宽广田洁宪大高诚治
OwnerOSAKA SODA CO LTD