Method for quickly identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin

A technology of Phytophthora capsicum and gene, applied in the field of molecular biology, can solve the problems of long test period, large workload, low sensitivity and the like, and achieve the effect of effectively controlling the development of drug-resistant diseases

Active Publication Date: 2015-05-27
CHINA AGRI UNIV
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Using conventional methods, when the frequency of resistant strains in the field is > 1%, it can be detected (if there is a 95% probability of detecting resistant strains with a frequency of 1%, the sample size for detection must be greater than 300), so it has sensitivity Low cost, heavy workload, long test cycle and other disadvantages

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin
  • Method for quickly identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin
  • Method for quickly identifying point mutation of nucleotide of phytophthora capsici leonian PcORP1 gene and pesticide resistance of mutant phytophthora capsici leonian PcORP1 gene to oxathiapiprolin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1, Phytophthora capsici Sensitivity Determination to Fluthiapiprofen

[0037]Six Phytophthora capsici resistant mutants, the strain numbers are R3-H, R3-F, R3-K, R3-M, R3-I and R3-P; four Phytophthora capsici sensitive strains, the strain numbers are HD11, LP3, YY7 and JZ10.

[0038] Potato dextrose agar (PDA) medium: 200 g of potatoes, 15 g of agar powder, 20 g of glucose, distilled water to 1 L, sterilized at 121° C. for 20 minutes by moist heat.

[0039] 1. The experimental steps are as follows:

[0040] 1) Mix thiazolidinone with dimethyl sulfoxide (DMSO) to make 10 4 μg / ml stock solution. For the sensitivity determination of Phytophthora capsici sensitive strains, fluthiapiprofen was diluted stepwise into a concentration gradient of 0.001 μg / mL, 0.0008 μg / mL, 0.0006 μg / mL, 0.0004 μg / mL, and 0.0002 μg / mL; For the sensitivity determination of Phytophthora capsici resistant strains, the test agent fluthiapiprofen was diluted stepwise to 2 μg / mL, 1 μg / ...

Embodiment 2

[0049] Example 2, Discovery of PcORP1 gene and PcORP1 protein mutation sites in Phytophthora capsici

[0050] 1. Strains: sensitive strains HD11, YY7, LP3 and JZ10; resistant strains R3-H, R3-F, R3-K, R3-M, R3-I and R3-P.

[0051] 2. Method:

[0052] 1) Strain cultivation: Use PDA medium (200 g of peeled potatoes, 20 g of glucose, 15 g of agar powder, and distilled water to make up to 1 L. 121 ° C, 20 min, after moist heat sterilization) to cultivate Phytophthora capsici at 28 ° C. The pre-cultured Phytophthora capsici sensitive strains were inoculated on PDA medium covered with cellophane, cultured in the dark at 28°C for 3 days, and the hyphae were collected, frozen in liquid nitrogen and stored at -80°C for genomic DNA extraction.

[0053] 2) Genomic DNA of Phytophthora capsici sensitive strains and resistant strains were extracted respectively:

[0054] Take an appropriate amount of mycelium frozen in liquid nitrogen, grind it into powder with a mortar, and place it in...

Embodiment 3

[0076] Embodiment 3, the method for detecting mutation site in Phytophthora capsici

[0077] 1. AS-PCR detection method

[0078] 1. Primer design

[0079] Primers are listed in Table 2.

[0080] Table 2. Primers used in AS-PCR detection of Phytophthora capsici resistance to fluthiapiprofen

[0081] Primer

Sequence(5'-3')

SEQ ID

PcORP1F1

TATGCTCAACACCAACAAGT

PcORP1F2

TATGCTCAACACCAACAACT

PcORP1F3

TATGCTCAACACCAACAATT

SEQ ID NO: 3

PcORP1F4

TATGCTCAACACCAACAAAT

PcORP1R

CCTTCCACTCTTGCGATT

SEQ ID NO: 4

[0082] In this method, the last base of the upstream primer is consistent with the mutant, and the penultimate base is also changed at the same time, and combined with different annealing temperatures for amplification, the specificity of the primer is improved. The reaction conditions are as follows:

[0083] The PCR reaction system is as follows:

[0084] 50-μl PCR syst...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for identifying point mutation of nucleotide of a phytophthora capsici leonian oxysteroid binding protein related gene PcORP1 and an application of the mutant phytophthora capsici leonian PcORP1 gene to monitoring resistance to a bactericide oxathiapiprolin, and specifically discloses two molecular detecting methods and special primers for identifying drug resistance of mutation of 2379-site nucleotide of the phytophthora capsici leonian PcORP1 gene. The mutation site refers to G and T heterozygosis or T homozygosis of 2379-site nucleotide from 5' tail end of the phytophthora capsici leonian PcORP1 gene, so that the 769-site amino acid from the N-terminal of PcORP1 protein is heterozygous glycine and tryptophane or homozygous tryptophane. The molecular detecting method provided by the invention is high in sensitivity, good in stability and short in detecting period, can be used for monitoring resistance gene frequency as well as resistance occurence and development condition of field phytophthora capsici leonian to the bactericide oxathiapiprolin with high throughput, so that early warning of resistance to diseases is realized, the control strategy of the phytophthora capsici leonian is guided and timely regulated, the pesticide use is rational, the occurrence and the development of pesticide resistance are delayed, and an important role is played in a sustainable management system of diseases.

Description

technical field [0001] The present invention relates to the identification of nucleotide point mutations of Phytophthora capsici oxidosterol-binding protein-related protein PcORP1 gene and its application in the detection of resistance to fungicide fluthiazolidinone, and specifically discloses a rapid identification of Phytophthora capsici Molecular detection method and special primers for the nucleotide point mutation of PcORP1 gene and its resistance to fluthiapiprofen. It belongs to the technical field of molecular biology. Background technique [0002] Phytophthora capsici Leonian is an important soil-borne phytopathogenic oomycete with a wide range of hosts, infecting at least 71 species of host plants in 27 families. Capsicum blight caused by Phytophthora capsici infecting peppers is a devastating disease distributed worldwide. It occurs widely in my country and tends to increase year by year. Under the condition of suitable climate, it can break out in a short perio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/31C07K14/37
CPCC07K14/37C12Q1/6858C12Q2521/301
Inventor刘西莉苗建强林东董雪蔡萌庞智黎刘鹏飞李健强罗来鑫
OwnerCHINA AGRI UNIV