Establishment and application of Streptococcus suis type 2 cell wall protein antibody detection method
A technology of Streptococcus suis and Streptococcus, which is applied in the establishment and application field of detection of Streptococcus suis cell wall protein antibody, can solve the problem of inability to determine the infection antibody or immune antibody of Streptococcus suis, and achieve low detection cost, Good sensitivity and specificity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Embodiment 1: the extraction of swine type 2 Streptococcus genomic DNA
[0056] The Streptococcus suis type 2 preserved in our laboratory was inoculated on TSA medium containing 10% inactivated newborn bovine serum, and a single colony was picked and inoculated in TSB liquid medium, placed on a shaker at 150 r / min, 37°C Incubate overnight with shaking. Take 1.0 ml of bacterial liquid in a 1.5 ml centrifuge tube, and extract streptococcal DNA according to the instructions of the Bacterial Genomic DNA Extraction Kit from TIANGEN Company.
Embodiment 2
[0057] Example 2: Amplification of the target gene
[0058] According to GenBank published Streptococcus suis type 2 strains sspA The sequence of the gene (GenBank accession number: CP000407.1, specifically as figure 1 shown) , using Primer Premier 5.0 software to design the fragment as sspA (328-3228 bp) primers, the underlined part is the introduced enzyme cutting site Eco RI and Sal I.
[0059] Primers are as follows:
[0060] SspA upstream primer U 5'–GC GAATTC tggcattggtatatgcgcttccgat–3'
[0061] Downstream Primer D 5'–C GTC GAC cctacggtcaacttagaattgaagC–3'
[0062] The upper and lower primer restriction sites contain restriction restriction bases, which are GC and C bases, respectively. Primers were synthesized by Shanghai Sangon Biotechnology Company. The extracted DNA was amplified by PCR in a 50 μl system. PCR products were detected by 1.2% agarose gel electrophoresis. see results image 3 , the size of the amplified band is consistent ...
Embodiment 3
[0063] Example 3: Construction and Screening of Expression Recombinant Plasmids
[0064]The PCR amplified product of the target gene fragment was digested with the corresponding endonuclease, and the pET28a vector was digested with the same double enzymes, recovered and purified separately, and transformed into Escherichia coli DH5α after T4 DNA ligase ligation. The positive clones were screened with bacterial liquid, and the plasmids of the positive clones were sequenced. The recombinant plasmid was heat-shock transformed into E. coli BL21 competent, and finally the prokaryotic expression vector carrying the target fragment was obtained. pET28a- sspA for cloning Eco RI and Sal Ⅰ The double enzyme digestion identification is consistent with the expected size, which further indicates that the target gene has been successfully cloned into the expression vector. Plasmid double enzyme digestion identification after cloning of the target fragment, see Figure 4 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 