Haynaldia villosa mitogen activated protein kinase gene, and expression vector and application thereof
A protein kinase gene and mitogen activation technology, applied in the field of genetic engineering, can solve problems such as limiting the systematic research on resistance mechanisms and the difficulty of cloning powdery mildew resistance genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Cloning of the mitogen-activated protein kinase gene Hv-MPK12 of tufted wheat
[0023] In the early stage of our laboratory, the cDNA samples induced by powdery mildew of tufted wheat were used to hybridize with the barley expression profiling chip Barley 1 GeneChip (http: / / www.affymetrix.com / products / arrays / specific / barley.affx). By comparing The expression profiles of disease-resistant tufted wheat before and after inoculation with powdery mildew were used to screen out up-regulated genes, including disease course-related proteins, defense response genes, transcription factors, signal transduction factors, and disease resistance gene analogs. According to the hybridization results of the chip, the probe Contig4711, which was upregulated and designed according to the disease resistance-related calcium channel gene, was selected and annotated as a MAPK gene by NCBI, and Primer3 ( http: / / www.genome.wi.mit.edu / cgi-bin / primer / primer3www.cgi ) to design full-l...
Embodiment 2
[0025] Example 2 Analysis of the expression characteristics of Hv-MPK12 after powdery mildew induction
[0026] Real-time quantitative qPCR analysis was carried out using the cDNAs of non-induced and induced samples of different times as templates, and primer pairs P3 (CTAGCTAGCTGGGGCTAATGTATTTCATC (SEQ ID NO. 5)) and P4 (CTAGCTAGCAAAAGGAGCCACATAATTCA (SEQ ID NO. 6)). , with the housekeeping gene Tubulin as the internal reference. PCR reactions were amplified on a real-time PCR instrument (MyIQ, Bio-Rad, USA) and fluorescence was detected. A 20 μl PCR reaction system contains 10 μl of 2×SYBR Green PCR Master Mix, 0.4 nmol / μl primers P3 and P4, and 2 μl of reverse transcription product. The amplification parameters were: 95°C for 10 min, followed by 40 cycles of 95°C for 15s, 58°C for 30s, and 72°C for 1 min. After the completion of the reaction, measurement of the melting curve was performed. Quantitative analysis of gene expression levels was performed with MyiQ system sof...
Embodiment 3
[0027] Example 3 Construction of the expression vector of Hv-MPK12 gene and its transformation into common wheat Yangmai 158
[0028] The Hv-MPK12 gene fragment amplified from P. tulipa cDNA with P5 (CTAGCAAGGAATCGAAGCGTA (SEQ ID NO. 7)) and P6 (CTAGCCCAGCAGAAATGACAG (SEQ ID NO. 8)) was constructed into the transformation vector pBI 220-6 (the well-known Public, reference: Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6:3901-3907), with BamH I and Kpn I The vector pBI 220-6 and the target fragment Hv-MPK12 gene were respectively double-enzyme digested, connected and transformed into Escherichia coli to obtain a recombinant, and the target gene was cloned into the downstream of the strong promoter 35s to obtain the expression vector pBI220:HvEREBP ( figure 2 ).
[0029]The constructed overexpression vector was transformed into Yangmai 158 by biolistic method, and a total of ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com