Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Haynaldia villosa mitogen activated protein kinase gene, and expression vector and application thereof

A protein kinase gene and mitogen activation technology, applied in the field of genetic engineering, can solve problems such as limiting the systematic research on resistance mechanisms and the difficulty of cloning powdery mildew resistance genes

Active Publication Date: 2015-07-15
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Previous studies on wheat powdery mildew resistance mainly focused on the discovery and cloning of powdery mildew resistance genes. Although many powdery mildew resistance genes have been discovered, due to the complexity of the wheat genome, the cloning of powdery mildew resistance genes is extremely difficult and limited. Systematic Study of Adversarial Mechanism

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Haynaldia villosa mitogen activated protein kinase gene, and expression vector and application thereof
  • Haynaldia villosa mitogen activated protein kinase gene, and expression vector and application thereof
  • Haynaldia villosa mitogen activated protein kinase gene, and expression vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Cloning of the mitogen-activated protein kinase gene Hv-MPK12 of tufted wheat

[0023] In the early stage of our laboratory, the cDNA samples induced by powdery mildew of tufted wheat were used to hybridize with the barley expression profiling chip Barley 1 GeneChip (http: / / www.affymetrix.com / products / arrays / specific / barley.affx). By comparing The expression profiles of disease-resistant tufted wheat before and after inoculation with powdery mildew were used to screen out up-regulated genes, including disease course-related proteins, defense response genes, transcription factors, signal transduction factors, and disease resistance gene analogs. According to the hybridization results of the chip, the probe Contig4711, which was upregulated and designed according to the disease resistance-related calcium channel gene, was selected and annotated as a MAPK gene by NCBI, and Primer3 ( http: / / www.genome.wi.mit.edu / cgi-bin / primer / primer3www.cgi ) to design full-l...

Embodiment 2

[0025] Example 2 Analysis of the expression characteristics of Hv-MPK12 after powdery mildew induction

[0026] Real-time quantitative qPCR analysis was carried out using the cDNAs of non-induced and induced samples of different times as templates, and primer pairs P3 (CTAGCTAGCTGGGGCTAATGTATTTCATC (SEQ ID NO. 5)) and P4 (CTAGCTAGCAAAAGGAGCCACATAATTCA (SEQ ID NO. 6)). , with the housekeeping gene Tubulin as the internal reference. PCR reactions were amplified on a real-time PCR instrument (MyIQ, Bio-Rad, USA) and fluorescence was detected. A 20 μl PCR reaction system contains 10 μl of 2×SYBR Green PCR Master Mix, 0.4 nmol / μl primers P3 and P4, and 2 μl of reverse transcription product. The amplification parameters were: 95°C for 10 min, followed by 40 cycles of 95°C for 15s, 58°C for 30s, and 72°C for 1 min. After the completion of the reaction, measurement of the melting curve was performed. Quantitative analysis of gene expression levels was performed with MyiQ system sof...

Embodiment 3

[0027] Example 3 Construction of the expression vector of Hv-MPK12 gene and its transformation into common wheat Yangmai 158

[0028] The Hv-MPK12 gene fragment amplified from P. tulipa cDNA with P5 (CTAGCAAGGAATCGAAGCGTA (SEQ ID NO. 7)) and P6 (CTAGCCCAGCAGAAATGACAG (SEQ ID NO. 8)) was constructed into the transformation vector pBI 220-6 (the well-known Public, reference: Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987, 6:3901-3907), with BamH I and Kpn I The vector pBI 220-6 and the target fragment Hv-MPK12 gene were respectively double-enzyme digested, connected and transformed into Escherichia coli to obtain a recombinant, and the target gene was cloned into the downstream of the strong promoter 35s to obtain the expression vector pBI220:HvEREBP ( figure 2 ).

[0029]The constructed overexpression vector was transformed into Yangmai 158 by biolistic method, and a total of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Haynaldia villosa mitogen activated protein kinase gene Hv-MPK12 and a protein encoded thereby, and belongs to the field of gene engineering. The cDNA sequence of the Hv-MPK12 is represented by SEQ ID NO.1, and the amino acid sequence encoded thereby is represented by SEQ ID NO.2. The gene is from Haynaldia villosa L. (2n=2x=14, genome VV), and powdery mildew fungus induced expression enhancement of the gene in powdery mildew-resistant Haynaldia villosa L. (2n=2x=14, genome VV) is realized. The gene is transformed to an infected wheat species Yangmai 158, and a result shows that the overexpression of the Hv-MPK12 gene can enhance the wheat powdery mildew resistance of the Yangmai 158. The Hv-MPK12 is expected to be used in gene engineering breeding, and can be introduced in to wheat species susceptible to powdery mildew in order to possibly improve the powdery mildew resistance of wheat.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and discloses a tufted wheat mitogen-activated protein kinase gene Hv-MPK12 and its expression vector and application. Background technique: [0002] Wheat is one of the most important food crops in my country and even in the world, but its growth and development are subject to a variety of abiotic and biotic stresses. Wheat powdery mildew caused by Blumeria graminis f.sp tritici is one of the main diseases of wheat. It belongs to specialized parasitism and can infect the leaves, stems, ears, etc. of wheat throughout the growth period. Among them, it mainly harms wheat leaves, and in severe cases, affects the normal photosynthesis of wheat, thereby affecting its normal growth and reducing yield. In general, wheat powdery mildew can reduce wheat yield by 5-19%, and in severe cases, it can reduce wheat yield by more than 30% (Li Zhenqi et al., 1997). Since the 1990s, the annual incidence of wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/12C12N15/82A01H5/00
Inventor 邢莉萍胡平崔超凡李美娜周传玉曹爱忠王秀娥王海燕肖进张瑞奇袁春霞
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com