Heterologous expression of polypeptide XZZ-5 and application of polypeptide XZZ-5 to enhancement of tumor killing activity of CIK (Cytokine Induced Killer) cells

A technology of XZZ-5 and DC-CIK, which is applied in the application field of peptides in enhancing the anti-tumor activity of CIK cells, to achieve the effects of prolonging tumor-bearing survival, high protein production, and reducing tumor burden

Active Publication Date: 2016-01-20
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The polypeptide XZZ-5 of the present invention induces and enhances the tumoricidal activity of CIK or DC-CIK cells, which is the first time, and there is no related report at home and abroad so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heterologous expression of polypeptide XZZ-5 and application of polypeptide XZZ-5 to enhancement of tumor killing activity of CIK (Cytokine Induced Killer) cells
  • Heterologous expression of polypeptide XZZ-5 and application of polypeptide XZZ-5 to enhancement of tumor killing activity of CIK (Cytokine Induced Killer) cells
  • Heterologous expression of polypeptide XZZ-5 and application of polypeptide XZZ-5 to enhancement of tumor killing activity of CIK (Cytokine Induced Killer) cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] "Example 1" amplification of polypeptide XZZ-5 sequence

[0056] According to the amino acid sequence of histone H2A (accession number: NP-003508) in Genbank and according to the codon preference, the gene encoding and synthesizing histone H2A was designed and named XZZ-5. Amplification primers XZZ-5-sense and XZZ-5-anti were designed according to the sequence of XZZ-5.

[0057] The primer sequences are as follows:

[0058] XZZ-5-sense:GGGAATTCCATATGATGTCTGGTCGTGGTAAACAAGGT

[0059] XZZ-5-anti:CCCAAGCTTTCATTTAGATTTCGCTTTGTGAGAT

[0060] The PCR amplification system is: 2×PCRmix10μl, ddH 2 O8μl, template DNA 1μl (about 50ng-200ng), upstream and downstream primers each 0.5μl (concentration is 20μM). The PCR reaction conditions were: 96°C, 2min pre-denaturation; 96°C, 1min denaturation, 56°C, 30s annealing, 72°C extension 40s (30 cycles); finally 72°C extension 5min, 4°C storage.

Embodiment 2

[0061] "Example 2" Construction of recombinant plasmid expressing XZZ-5 polypeptide

[0062] After PCR amplification, first use 1% agarose gel for electrophoresis, the voltage is 120 volts, after cutting the gel, use the gel recovery kit (Beijing Kangwei Century Biotechnology Co., Ltd.) to recover the target DNA fragment of about 390bp, and then Carry out double digestion with NdeI and HindIII, connect the obtained DNA fragment and vector pET-28a (Bao Biological Engineering Co., Ltd.), and then transform the ligation product into E. coli DH5a competent cells (Beijing Quanshijin Biotechnology Co., Ltd. ), screened on LB plates containing kanamycin antibiotics.

[0063] Recombinants were verified by double digestion with restriction endonucleases NdeI and HindIII. The digested products were subjected to agarose gel electrophoresis at a voltage of 120 volts, and the fragment sizes were verified to be about 390 bp and about 5300 bp, respectively. The construction of recombinant ...

Embodiment 3

[0064] "Example 3" Obtaining of Monoclonal Cell Line Expressing Polypeptide XZZ-5

[0065] Use the plasmid extraction kit (Beijing Kangwei Century Biotechnology Co., Ltd.) to extract the recombinant plasmid, and then transform it into the expression host E.coliBL21 (Beijing Quanshijin Biotechnology Co., Ltd.) according to the conventional method to obtain the polypeptide XZZ-5 gene. Escherichia coli engineering bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to application of a polypeptide XZZ-5 to induction and enhancement of tumor killing activity of CIK (Cytokine Induced Killer) cells. A research shows that the polypeptide XZZ-5 is used for inducing CIK or DC-CIK cells, and the multiplication and differentiation of the cells can be effectively enhanced, so that the tumor killing activity of the cells is improved; the application is hopefully developed to a brand new biological therapy manner.

Description

Technical field: [0001] The invention belongs to the fields of biopharmaceuticals and biotherapy, and relates to the application of a polypeptide in enhancing the antitumor activity of CIK cells. Background technique: [0002] Malignant tumors have become the number one cause of death in my country, threatening people's health and life seriously. How to improve the quality of life of patients with malignant tumors has become a research hotspot. At present, conventional tumor treatment methods mainly include chemotherapy, radiotherapy and surgery. [0003] Biological therapy is an emerging tumor treatment mode with significant curative effect. The clinical application belongs to the anti-cancer treatment method of autologous immune cells. It has been listed by the National Health and Family Planning Commission as the third type of technology that allows clinical application. Biological therapy includes cytokine therapy, immune cell therapy, gene therapy, molecular targeted t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/47C12N5/0783C12N5/0784A61P35/00
CPCC07K14/47C12N5/0636C12N5/0639C12N2506/11
Inventor 杨兆勇冯晓洲李亚东金媛媛白利平汪康游刘凡
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap