Heterologous expression of polypeptide XZZ-5 and application of polypeptide XZZ-5 to enhancement of tumor killing activity of CIK (Cytokine Induced Killer) cells
A technology of XZZ-5 and DC-CIK, which is applied in the application field of peptides in enhancing the anti-tumor activity of CIK cells, to achieve the effects of prolonging tumor-bearing survival, high protein production, and reducing tumor burden
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] "Example 1" amplification of polypeptide XZZ-5 sequence
[0056] According to the amino acid sequence of histone H2A (accession number: NP-003508) in Genbank and according to the codon preference, the gene encoding and synthesizing histone H2A was designed and named XZZ-5. Amplification primers XZZ-5-sense and XZZ-5-anti were designed according to the sequence of XZZ-5.
[0057] The primer sequences are as follows:
[0058] XZZ-5-sense:GGGAATTCCATATGATGTCTGGTCGTGGTAAACAAGGT
[0059] XZZ-5-anti:CCCAAGCTTTCATTTAGATTTCGCTTTGTGAGAT
[0060] The PCR amplification system is: 2×PCRmix10μl, ddH 2 O8μl, template DNA 1μl (about 50ng-200ng), upstream and downstream primers each 0.5μl (concentration is 20μM). The PCR reaction conditions were: 96°C, 2min pre-denaturation; 96°C, 1min denaturation, 56°C, 30s annealing, 72°C extension 40s (30 cycles); finally 72°C extension 5min, 4°C storage.
Embodiment 2
[0061] "Example 2" Construction of recombinant plasmid expressing XZZ-5 polypeptide
[0062] After PCR amplification, first use 1% agarose gel for electrophoresis, the voltage is 120 volts, after cutting the gel, use the gel recovery kit (Beijing Kangwei Century Biotechnology Co., Ltd.) to recover the target DNA fragment of about 390bp, and then Carry out double digestion with NdeI and HindIII, connect the obtained DNA fragment and vector pET-28a (Bao Biological Engineering Co., Ltd.), and then transform the ligation product into E. coli DH5a competent cells (Beijing Quanshijin Biotechnology Co., Ltd. ), screened on LB plates containing kanamycin antibiotics.
[0063] Recombinants were verified by double digestion with restriction endonucleases NdeI and HindIII. The digested products were subjected to agarose gel electrophoresis at a voltage of 120 volts, and the fragment sizes were verified to be about 390 bp and about 5300 bp, respectively. The construction of recombinant ...
Embodiment 3
[0064] "Example 3" Obtaining of Monoclonal Cell Line Expressing Polypeptide XZZ-5
[0065] Use the plasmid extraction kit (Beijing Kangwei Century Biotechnology Co., Ltd.) to extract the recombinant plasmid, and then transform it into the expression host E.coliBL21 (Beijing Quanshijin Biotechnology Co., Ltd.) according to the conventional method to obtain the polypeptide XZZ-5 gene. Escherichia coli engineering bacteria.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap