Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method and kit used for determining human PON1 gene rs662 site polymorphism

A site polymorphism, PON1 technology, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc., can solve the problem of high price, and achieve the effect of reduced measurement cost, good yield and specificity

Inactive Publication Date: 2016-01-20
ZHENGZHOU UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The rs662 polymorphic site of the PON1 gene is detected by PCR-RFLP technology, and the required endonucleases are Sau3AI, BfuCI, AlwI, MboI, DpnII, etc., which are relatively expensive, so new detection technologies need to be developed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit used for determining human PON1 gene rs662 site polymorphism
  • Method and kit used for determining human PON1 gene rs662 site polymorphism
  • Method and kit used for determining human PON1 gene rs662 site polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Extraction of Human Peripheral Blood Leukocyte DNA Determination of rs662 Polymorphism

[0059] 1 Materials and methods

[0060] 1.1 Main reagents and instruments

[0061] Reagent: 2×PCRMix (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), restriction enzyme Taq α I (NEB Company), agarose (Biowest Company), and primers were synthesized by Shanghai Sangon Company.

[0062] Instruments: Model 9600 PCR instrument (PE Company), mini electrophoresis tank (PHarmaciaBiotech, EPS1000), GelDoc2000 gel imager (Bio-RAD Company).

[0063] 1.2 Extract DNA from peripheral blood leukocytes as the template of genomic DNA to be tested

[0064] EDTA-K 2 Collect 1mL of human peripheral blood with an anticoagulant tube, and separate leukocytes by referring to the leukocyte separation method in "Practical Flow Cytometry Color Atlas", and extract leukocyte genomic DNA by referring to the sodium chloride salting-out m...

Embodiment 2

[0089] Example 2 Determination of PON1 Gene rs662 Polymorphism in Whole Blood Specimen of Human Peripheral Blood

[0090] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract peripheral blood genomic DNA and use it as a human genomic DNA template to be tested.

[0091] The sequence search was the same as in Example 1, and the primer sequences were designed as follows:

[0092] Upstream primer: 5'TTTTATGGCACAAATGATCACTATTTTCTTGACCCCTACTT T C3' (SEQ ID NO: 7);

[0093] Downstream primer: 5'TTCAGAGAGTTCACATACTTGCCAT3' (SEQ ID NO: 8)

[0094] Take genomic DNA (50-80ng), upstream and downstream primers (final concentration 0.1-1μM), 2×PCRMix 10μL (including 4 kinds of dNTP mixture, Mg 2+ , TaqDNApolymerase, TaqAntibody, buffer, DMSO and ammonium sulfate), sterilized double distilled water to make up 20 μL of the reaction system, and adjust the pH of the solution to about 7.3...

Embodiment 3

[0109] Example 3 Determination of PON1 gene rs662 polymorphism in human peripheral blood clot specimen

[0110] The main reagents and instruments are the same as in Example 1. Refer to the phenol-chloroform extraction method in "Molecular Cloning Technology" to extract genomic DNA from blood clots.

[0111] The upstream primer used in the PCR reaction is SEQNO:12, and the downstream primer is SEQNO:13.

[0112] Upstream primer: 5'ACTTTTATGGCACAAATGATCACTATTTTCTTGACCCCTACTT T C3' (SEQ ID NO: 12);

[0113] Downstream primer: 5'TCCTTCTGCCACCACTC3' (SEQ ID NO: 13)

[0114] Except that the annealing temperature of PCR amplification is 57° C., the other reaction conditions are the same as in Example 1; the enzyme digestion reaction conditions are the same as in Example 1. After 1-fold concentration, the digested product was subjected to electrophoresis on 2.5% agarose gel at 5V / cm for 35min, and photographed under ultraviolet light for identification.

[0115] result:

[0116]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method and a kit used for determining human PON1 gene rs662 site polymorphism. The method comprises following steps: human genome DNA to be determined is provided; upstream primers and downstream primers used for amplification of sequences near human PON1 gene rs662 site are provided, wherein the upstream primers possess mismatched base T; the human genome DNA to be determined is taken as a template, and the upstream primers and the downstream primers are used for PCR amplification so as to obtain amplification products containing TCRA segments, wherein R is used for representing base A or G to be determined on human PON1 gene rs662 site; a restriction enzyme is provided; the restriction enzyme is used for enzyme digestion of the amplification products so as to obtain corresponding enzyme-digested products; and it is determined that R is used for representing base A or G based on the enzyme-digested products. The restriction enzyme is a restriction enzyme only used for realizing restriction digestion of one segment selected from TCGA and TCAA. The method is rapid and reliable, and determination cost is reduced greatly.

Description

technical field [0001] The present invention relates to methods for determining single nucleotide polymorphisms. Background technique [0002] SNP (Single Nucleotide Polymorphism) refers to the DNA sequence variation caused by the change of a single nucleotide, including single base substitution, insertion and deletion. Gene polymorphism is an individual's innate genetic characteristics, does not change with the environment, and is not a specific or non-specific clinical manifestation of a certain disease, so its application does not have diagnostic and therapeutic functions. [0003] Gene polymorphism detection is widely used in the field of genetics and medicine, examples are as follows: 1. To study genetic phenomena such as the origin and evolution of species. According to the genetic variation, the information of biological macromolecules can be obtained, the history of biological evolution can be inferred, and the evolution relationship of species can be clarified. It...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2521/301C12Q2525/117
Inventor 杨永利施学忠杜玉慧贾晓灿靳慧鸣王莹段晓冉冯晓蕾姚武王威
Owner ZHENGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products