Method for preparing soluble penaeus chinensis SWD antibacterial peptide through yeast recombinant expression
A technology of Chinese prawns and antimicrobial peptides, applied in the field of genetic engineering, can solve the problems of reducing yield and increasing the difficulty of industrial production, and achieve the effect of avoiding toxicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Construction of Pichia pastoris recombinant expression vector
[0027] The main steps include:
[0028] 1) PCR cloning of the cDNA fragment of the mature peptide gene of the antibacterial peptide containing a single whey acidic protein domain in Penaeus chinensis
[0029] According to each shrimp 3×10 6 The amount of bacteria in cfu, inject the live Vibrio into the base of the telson of the prawn, and feed it with air for 24 hours, extract the total RNA of the induced hemocytes of the prawn and reverse transcribe it into a SMART cDNA as a template (refer to the kit manual), and the specific steps include: adding 5 μl of the RNA solution Add SMARTF (TACGGCTGCGAGAAGACGACAGAAGGG) and OligoanchorR (GACCACGCGTATCGATGTCGACT 16 (A / C / G)) 1 μl of each primer, primer concentration 100 μmol / μl, add RNase-free water to 11 μl, mix well, place in 70°C water bath for 5 minutes, immediately ice-bath, add MMLV buffer 4 μl, 10 mmol / ldNTP 2 μl in turn , 0.5 μl of RNase inhibitor, suppl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 