Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for preparing soluble penaeus chinensis SWD antibacterial peptide through yeast recombinant expression

A technology of Chinese prawns and antimicrobial peptides, applied in the field of genetic engineering, can solve the problems of reducing yield and increasing the difficulty of industrial production, and achieve the effect of avoiding toxicity

Inactive Publication Date: 2016-03-09
UNIV OF JINAN
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the SWD recombinant protein produced by prokaryotic expression exists in the form of insoluble inclusion bodies (see the paper JiaYP, SunYD, WangZH, WangQ, WangXW, ZhaoXF, WangJX.Asinglewheyacidicproteindomain(SWD)-containingpeptidefromfleshyprawnwithantimicrobialandproteinaseinhibitoryactivities. ), to use it must go through complex denaturation and renaturation steps, which not only reduces the yield, but also increases the difficulty of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing soluble penaeus chinensis SWD antibacterial peptide through yeast recombinant expression
  • Method for preparing soluble penaeus chinensis SWD antibacterial peptide through yeast recombinant expression
  • Method for preparing soluble penaeus chinensis SWD antibacterial peptide through yeast recombinant expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Construction of Pichia pastoris recombinant expression vector

[0027] The main steps include:

[0028] 1) PCR cloning of the cDNA fragment of the mature peptide gene of the antibacterial peptide containing a single whey acidic protein domain in Penaeus chinensis

[0029] According to each shrimp 3×10 6 The amount of bacteria in cfu, inject the live Vibrio into the base of the telson of the prawn, and feed it with air for 24 hours, extract the total RNA of the induced hemocytes of the prawn and reverse transcribe it into a SMART cDNA as a template (refer to the kit manual), and the specific steps include: adding 5 μl of the RNA solution Add SMARTF (TACGGCTGCGAGAAGACGACAGAAGGG) and OligoanchorR (GACCACGCGTATCGATGTCGACT 16 (A / C / G)) 1 μl of each primer, primer concentration 100 μmol / μl, add RNase-free water to 11 μl, mix well, place in 70°C water bath for 5 minutes, immediately ice-bath, add MMLV buffer 4 μl, 10 mmol / ldNTP 2 μl in turn , 0.5 μl of RNase inhibitor, suppl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of gene products and application and relates to a method for preparing a soluble penaeus chinensis SWD antibacterial peptide through yeast recombinant expression. The method includes the following steps that 1, a swd / PGAPZ alpha-A recombinant expression vector is established; 2, a high-expression penaeus chinensis yeast strain swd / PGAPZ alpha-A / GS115 is obtained; 3, optimal yeast fermentation culture and expression conditions are established; 4, a SWD recombinant protein is purified; 5, activity detection is conducted on the SWD recombinant protein. The method establishes a simple and efficient yeast eukaryotic expression system to simply and efficiently produce and prepare the SWD antibacterial peptide, and the SWD antibacterial peptide produced by means of the method is soluble in water, high in activity and easy to purify and recover, meanwhile has the double functions of antisepsis and protease activity inhibition, has the advantage of industrial production and has wide application prospect in the fields of feed and food additives, daily chemical industry and health and medicines.

Description

technical field [0001] The invention relates to a method for recombinantly expressing soluble Chinese prawn SWD antibacterial peptide by yeast, which belongs to the technical field of genetic engineering. Background technique [0002] With the widespread use or even abuse of antibiotics, the problems of antibiotic residues and bacterial resistance have attracted more and more attention from all over the world. It has become a worldwide research topic to develop new antibacterial drugs to replace traditional antibiotics as soon as possible. [0003] Antimicrobial peptides are a class of small molecular polypeptides with antibacterial effects discovered in insects in the 1970s. They exist in most organisms and play a very important role in invertebrates' resistance to the invasion of bacteria, viruses, fungi and other pathogenic bacteria. role. Antimicrobial peptides can be used not only in pharmaceuticals but also in food, animal husbandry, aquaculture, daily chemical indust...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/12C07K14/435
Inventor 李殿香栾圆圆于洋
Owner UNIV OF JINAN