Double-functional acidic urease structural gene as well as expression and application thereof
A structural gene, dual-function technology, applied in the field of bioengineering, can solve problems such as urease restriction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1 recombinant vector construction
[0044] The urease structural gene ureABC is obtained by chemical synthesis or PCR cloning, and the present invention uses PCR cloning as an example for introduction.
[0045] In order to realize the expression of acid urease gene in Escherichia coli, a pair of gene primers were designed with acid urease structural gene ureABC.
[0046] Fs: CCG GAATTC ATGCAATTAACCCCAAGGGAAATTGAA (EcoRI);
[0047] Rs: ACGC GTC GAC TTAACCAAAGAAATAACGTTGGTTCAT (Sal I);
[0048] The underline indicates the base sequence of the restriction site.
[0049] The genome of Providencia was used as a template, and Fs and Rs were used as primers to amplify the target gene. The PCR system is (50 μL): 25 μL of PrimerSTAR enzyme; 1 μL of genome; 1 μL of Fs; 1 μL of Rs; ddH 2 O22 μL. The PCR conditions were: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 59°C for 30 s, extension at 72°C for 3 min; extension at 72°C for...
Embodiment 2
[0061] Example 2 Recombinant E.coliBL21(DE3) induces the expression of soluble acid urease Pick the above recombinant E.coliBL21(DE3), and inoculate it in 50mL LB with 1% inoculum size, which contains 50 μg / mL of kanamycin, NiSO 4 0.05g / L, cultured to OD at 37℃, 200rpm 600 When the value is between 0.8 and 1.0, add IPTG to a final concentration of 0.5mM, and culture at 25°C and 200rpm for 10h. The obtained fermentation broth was centrifuged at 10,000 rpm for 10 min, the supernatant was discarded, and the cell pellet was resuspended with 10 mL of 25 mM pH4.5 citric acid buffer, ultrasonicated, and the supernatant was collected by centrifugation to obtain a crude urease solution.
Embodiment 3
[0062] Example 3 Purification of acid urease The crude urease solution obtained in the previous step was placed in neutral PBS buffer and dialyzed for 24 hours. Affinity chromatography was performed on a nickel column with a column volume of 30 mL. Mobile phase A was PBS containing 20 mM imidazole, mobile phase B was PBS containing 500 mM, and the flow rate was 0.5 mL / min. Finally, the obtained urease was verified to be electrophoretic pure by SDS-PAGE. The purified soluble acid urease exhibits the same bifunctional enzyme activity as the original enzyme. And the ratio of specific activity between urease and EC degrading enzyme remains the same as that of the original enzyme, about 3:1. The specific activity of urease is 2.1U / mg, and the specific activity of urethane degrading enzyme is 0.6U / mg.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More