Preparation process and application of interleukin-10

A technology for the preparation of interleukins, which is applied to medical preparations containing active ingredients, peptide/protein components, and the use of carriers to introduce foreign genetic materials. The effect of reducing the loss of activity

Inactive Publication Date: 2016-05-25
ZUNYI MEDICAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention intends to provide a preparation process of interleukin-10 to solve the problem of prokaryotic and eukaryotic expression research of rhIL-10. Due to the different expression systems, the yield and purification efficiency are different, which cannot be satisfied as Questions about Drug Development Requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation process and application of interleukin-10
  • Preparation process and application of interleukin-10
  • Preparation process and application of interleukin-10

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Such as figure 1 Shown: the preparation process of interleukin-10, including preparation by the following steps:

[0056] Step 1, PCR amplification of the hIL-10 gene: according to the full length of the hIL-10 gene and the multiple cloning site in the plasmid pPICZαA, primers were designed with the software PimerPremier.

[0057] Upstream primer: 5'CG GAATTC ATGGCCCACAGCTCAGCA3',

[0058] Downstream primer: 5'GC TCTAGA CAGTTTCGTATCTTCATTGTC3'.

[0059] The part underlined in italics is the introduced EcoRI site XbaI site. Using the plasmid pORF-hIL-10 as a template, hIL-10 was amplified by PCR. The PCR reaction conditions were: in a 50μl reaction system, 94°C, pre-denatured for 10min, 94°C for 45s, 52°C, annealed for 45s, 72°C, extended for 1min , 35 cycles, 72°C extension 10min. After PCR, the amplification results were observed by 1.0% agarose gel electrophoresis as follows: figure 2 As shown in the electrophoresis results, it can be seen that the PCR a...

Embodiment 2

[0170] Example 2: Application in Anti-Skin Graft Rejection in Rabbits

[0171] 1. Application of rhIL-10 anti-rabbit skin graft:

[0172] (1) Optimizing the conditions of the rabbit skin transplantation model, three recipient areas were prepared on the right side of the back of each rabbit, and the skin was peeled, with an area of ​​1.5×1.5cm 2 , with neat edges. When taking the skin, it is advisable that there are many dense and small bleeding spots on the wound. The optimal thickness of the skin graft is 10-15 mm, including the dermis, and the basement membrane is removed, and the skin graft is trimmed; the operation time is closely related to the survival time, and the operation time within 30 minutes is conducive to the survival of the skin graft.

[0173] (2) Rabbit skin transplantation experiments were administered from the day before transplantation for 10 consecutive days.

[0174] (3) Dosage and method: the first group rhIL-10 dose was 10 μg / kg / d, intramuscular inj...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Relative molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation process and application of interleukin-10 and belongs to the technical field of medical biology. The preparation process includes: performing PCR amplification on hIL-10 genes, building a hIL-10 expression vector, transforming DH5 alpha competent cells, identifying recombinant plasmids, screening electro-transformed pichia pastoris X-33 strain recombinant yeast, performing rhIL-10 protein expression and preparing identification reagent, performing induced expression of rhIL-10, detecting and separating rhIL-10, identifying Westernblot, and split charging and storing. The prepared rhIL-10 plays an important role in various diseases such as autoimmune diseases, infectious diseases, tumors and transplantation immunity diseases. The key technologies of the preparation process include the modified formula of a culture medium allowing for the induced expression of hIL-10 in pichia pastoris X-33, the culture conditions, the starting yeast concentration, the target protein collecting time and the purifying technology of the rhIL-10. The application of the rhIL-10 includes application of the rhIL-10 to rabbit skin transplantation models resisting skin inhibition and rejection reaction and to animal experiments and application of the rhIL-10 to experimental therapy of rat models resisting adjuvant arthritis.

Description

technical field [0001] The invention relates to the technical field of medicine and biology, in particular to a preparation process and application of interleukin-10. Background technique [0002] Interleukin-10 (Interleukin-10, IL-10) is a cytokine discovered by Fiorentino of the DNAX Institute in the United States. It is produced by the Th2 cell line D10.G4.1 of the mouse and can inhibit the Th1 cell line. transcription of factor mRNA. Its cDNA has 534bp, encoding a polypeptide chain composed of 178 amino acids, of which the 18 amino acids at the amino terminal are signal peptides, mature hIL-10 is composed of 160 amino acid residues, and the molecular weight of the single chain is 18.5kD. Due to the different degrees of glycosylation, the homologous oligodimer form of non-covalent linkage has a slight difference in molecular weight, which is about 37.0kD. Studies have found that hIL-10 (human interleukin humanIL-10) can be produced by various cells in the human body, ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P21/02C12N15/81A61K38/20A61P37/06
CPCC07K14/5428A61K38/13A61K38/2066A61K2300/00
Inventor陈富超孙万邦罗军敏张磊刘凯山温琼娜
OwnerZUNYI MEDICAL UNIVERSITY