Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of Simian Virus 40 Capsid Protein vp1 as Cell Penetrating Protein

A capsid protein, virus technology, applied in the field of cell transduction, can solve the problems of low efficiency, low practical utilization, strong damage and so on

Active Publication Date: 2019-10-25
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional techniques for mediating exogenous substances into cells include electroporation, microinjection, virus delivery systems, repeated freeze-thaw techniques, liposome encapsulation, etc. heavily restricted
In addition, after the drug enters the cell, due to the degradation of lysosomes, the actual utilization is often very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Simian Virus 40 Capsid Protein vp1 as Cell Penetrating Protein
  • Application of Simian Virus 40 Capsid Protein vp1 as Cell Penetrating Protein
  • Application of Simian Virus 40 Capsid Protein vp1 as Cell Penetrating Protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Simian virus 40 capsid protein VP1 gene, its preparation steps are as follows:

[0042] Using the pSV21SphI-N1 plasmid (Li et al, Small, 2009, 5:718-726) as a template, PCR amplification obtained the VP1 gene fragment of the simian virus 40 capsid protein, and the obtained VP1 gene sequence is shown in SEQ ID NO.1 , and the encoded amino acid sequence is shown in SEQ ID NO.2. The upstream primer used in PCR: VP1-S (NcoI): 5′CAGACCATGGATGAGAGGATCGCATCACCATCACCATCACGGATCTATGAAGATG 3′, the downstream primer: VP1-A (SacI): 5′GCTTGAGCTCGCACTGCATTCTAGTTGTGG 3′. PCR cycle conditions: denaturation at 94°C for 5 min; denaturation at 90°C for 1 min, annealing at 53°C for 40 s, extension at 72°C for 1 min and 30 s, and 30 cycle reactions; finally, extension at 72°C for 10 min. The amplified product was subjected to 1% agarose gel electrophoresis, the target band was excised under ultraviolet light, and the gel recovery and purification kit from Omega Company was used to recover. ...

Embodiment 2

[0044] Application of simian virus 40 capsid protein VP1 as a cell-penetrating peptide / verification of membrane penetration:

[0045] (1) CaCl for pET28a-hisVP1 plasmid 2 Transformed into E.coli Rosetta (DE3) competent cells by using the method, pick a single clone from the plate and put it into a 5mL LB test tube culture medium, and culture at 200r / min at 37°C overnight. The next day, transfer to 5mL LB test tube culture medium according to 1% inoculum amount, shake culture at 200r / min at 37°C overnight, transfer to 500mL LB Erlenmeyer flask the next day, and shake at 37°C at 200r / min until When the OD600 is between 0.4 and 0.6, add IPTG to a final concentration of 1 mM, continue to induce culture at 25 ° C for 8 h, collect the bacteria, and use loading buffer (25 mM Tris-HCl pH 7.8, 500 mM sodium chloride, 5 mM imidazole, 5% glycerol) washed once, resuspended in 40mL of binding buffer for sonication, centrifuged at 10000r / min for 30min, and the supernatant was loaded on the...

Embodiment 3

[0050] The application of monkey virus 40 capsid protein VP1 in the transduction of fluorescent protein mCherry into cells, the steps are:

[0051] (1) The fluorescent protein mCherry gene was inserted into the pET28a-hisVP1 vector through SacI and XhoI double restriction sites, and the plasmid pET28a-VP1mCherry was constructed, and the double restriction restriction plasmid was successfully constructed ( Figure 1-b ).

[0052] (2) The plasmid pET28a-VP1mCherry was transformed into E.coli Rosetta (DE3) competent cells. After the single clone was picked from the plate and expanded for culture, IPTG induced expression, and the fusion protein VP1- was purified by Ni2+-NTA column affinity chromatography. mCherry.

[0053] (3) fusion protein VP1-mCherry polyacrylamide gel electrophoresis, the molecular weight of VP1 protein is about 70kDa, the molecular weight of VP1-mCherry detected by polyacrylamide gel electrophoresis is consistent with the predicted value ( figure 2 Middle ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses an application of a simian virus 40 capsid protein VP1 serving as a cell transmembrane protein. Firstly, the VP1 is revealed to be a cell-penetrating protein, and then the VP1 protein is subjected to fusion expression with other proteins and can carry an exogenous protein to penetrate through a cell membrane so as to enter cells and be localized in cytoplasm. An experiment of the invention proves that the VP1 protein can carry a mCherry fluorescent protein and a cancer suppressor protein to penetrate through a cell membrane so as to enter cells and be localized in cytoplasm. The invention provides a simple and efficient cell transduction system, and realizes subcellular localization in cytoplasm, and a constructed VP1-P53 protein is expected to have potential applications in the aspects of tumor treatment and the like.

Description

technical field [0001] The invention relates to the technical field of cell transduction, and more specifically relates to the application of simian virus 40 capsid protein VP1 as a cell penetrating protein. The main capsid protein VP1 of Simian virus 40 can penetrate the mammalian cell membrane, enter the cell and localize in the cytoplasm. The SV40 VP1 protein is fused with other proteins, and VP1 can transduce the fused foreign protein into cells and localize in the cytoplasm. Background technique [0002] With the development of molecular biology theory and technology, new molecular therapeutic measures based on gene therapy, targeted protein drugs or peptide drugs have emerged, but these therapeutic methods are often based on the delivery of macromolecular substances into cells. Due to the selective permeability of the cell membrane, substances with strong polarity and large molecular weight such as proteins, polypeptides and DNA cannot pass through freely, and must re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/025C07K19/00C12N15/37
Inventor 崔宗强张先恩林秀萍张治平高丁
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI