Recombinant spider silk protein preparation method
A technology of spidroin protein and abdominal gland silk, applied in biochemical equipment and methods, recombinant DNA technology, chemical instruments and methods, etc., can solve problems such as high-density breeding, difficult domestication, gene recombination, etc., and achieve good morphological characteristics and biocompatibility, good biocompatibility, and low cost of raw materials
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Take 1 μL of the MiSp genome of E. grandina, 2.5 μL of a pair of forward and reverse primers designed with the sequence of the NT gene, add 25 μL of Q5MasterMIX enzyme, and finally add 19 μL of ddH2O to mix well, and perform PCR amplification on the NT gene. The PCR conditions are denaturation at 98°C for 3 minutes, 65 Annealing at ℃ for 1 min, extension at 72 °C for 10 min, 35 cycles in total, NT forward primer: CGGGATCCCAACCAATCTGGACCAACCCA, reverse primer: CTGGTCTAGGTGCAGGTGCTGGAGCGTTTCCATAACCTGCTGCAGTG; then design forward and reverse primers based on the PySp repeat region of E. spp. The reverse primer is: CG CTCGAGTTACGGTGCTGCCAGTTGAGATA, the forward primer of PySp has 23bp nucleotides at the end of NT, and the 23bp nucleotides behind the NT reverse primer are forward complementary to PySp. The PCR conditions were: denaturation at 98°C for 3 minutes, annealing at 65°C for 1 minute, extension at 72°C for 5 minutes, and 35 cycles. The two parts of the gene fragment...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com