Recombinant spider silk protein preparation method

A technology of spidroin protein and abdominal gland silk, applied in biochemical equipment and methods, recombinant DNA technology, chemical instruments and methods, etc., can solve problems such as high-density breeding, difficult domestication, gene recombination, etc., and achieve good morphological characteristics and biocompatibility, good biocompatibility, and low cost of raw materials

Active Publication Date: 2016-07-13
DONGHUA UNIV
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the large-scale mass production and bionic applications of spider silk still need to be strengthened, mainly for the following reasons: 1. Spiders are carnivorous animals, which are not easy to domesticate and cannot be raised in high density like silkworms; 2. The combination of natural spider silk 2. The silk forming mechanism and spinning process are extremely complex; 2. Using genetic engineering to express and produce recombinant spidroin in heterologous hosts is by far the most promising method
But this also faces difficulties, because the center of most spider silk proteins is a highly repetitive sequence, its molecular weight can reach more than 90%, and the repetitive region is rich in glycine and alanine
When expressing spider silk proteins with heterologous hosts, not only the problem of codon usage bias is faced, but this sequence characteristic also brings about the need for co-evolution of the library, and at the same time, this high content causes a special secondary structure and leads to gene recombination
Therefore, the produced spider silk protein reaches the size of natural spider silk protein, the yield is low, and the performance is far inferior to natural spider silk protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant spider silk protein preparation method
  • Recombinant spider silk protein preparation method
  • Recombinant spider silk protein preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Take 1 μL of the MiSp genome of E. grandina, 2.5 μL of a pair of forward and reverse primers designed with the sequence of the NT gene, add 25 μL of Q5MasterMIX enzyme, and finally add 19 μL of ddH2O to mix well, and perform PCR amplification on the NT gene. The PCR conditions are denaturation at 98°C for 3 minutes, 65 Annealing at ℃ for 1 min, extension at 72 °C for 10 min, 35 cycles in total, NT forward primer: CGGGATCCCAACCAATCTGGACCAACCCA, reverse primer: CTGGTCTAGGTGCAGGTGCTGGAGCGTTTCCATAACCTGCTGCAGTG; then design forward and reverse primers based on the PySp repeat region of E. spp. The reverse primer is: CG CTCGAGTTACGGTGCTGCCAGTTGAGATA, the forward primer of PySp has 23bp nucleotides at the end of NT, and the 23bp nucleotides behind the NT reverse primer are forward complementary to PySp. The PCR conditions were: denaturation at 98°C for 3 minutes, annealing at 65°C for 1 minute, extension at 72°C for 5 minutes, and 35 cycles. The two parts of the gene fragment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a recombinant spider silk protein preparation method.According to the method, full-length encoding genes of Araneus ventricosus minor ampullate spidroin(MiSp) and encoding genes of a full repeat region of pyriform spidroin(PySp) are taken as templates, gene segments are spliced to obtain a complete gene segment by a PCR fusion technique, the complete gene segment is connected with the pET28a carrier to construct recombinant plasmid, the recombinant plasmid is then transferred into BL21 for expression and is subjected to denaturation and purification to obtain recombinant spider silk protein solution, and the recombinant spider silk protein solution is subjected to freeze-drying preservation.The recombinant spider silk protein preparation method has the advantages of mild reaction condition, low cost, simple process and operational simplicity; the recombinant spider silk protein prepared by the method has good biocompatibility, high and predicable expression yield after being weighed, and is a potential protein fiber material having prospect of application based on industrialization.

Description

technical field [0001] The invention belongs to the field of protein preparation, in particular to a preparation method of recombinant spidroin protein. Background technique [0002] Spider silk is a natural high-molecular-weight protein fiber with good mechanical properties and biological qualities, such as high strength, good elasticity, light texture, high and low temperature resistance, and good biocompatibility. The overall quality far exceeds that of silk And the artificially synthesized high-performance material fiber at this stage is a strategic resource that needs to be developed urgently, and has inestimable application value in the fields of biomedical engineering, aerospace and military. However, the large-scale mass production and bionic applications of spider silk still need to be strengthened, mainly for the following reasons: 1. Spiders are carnivorous animals, which are not easy to domesticate and cannot be raised in high density like silkworms; 2. The combi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/62C12N15/70C07K19/00
CPCC07K14/43518C07K2319/00C12N15/70C12N2800/101
Inventor吴忠笏孟清
OwnerDONGHUA UNIV