Haynaldia villosa agglutinin receptor-like kinase gene and expression vector and application
A kind of receptor kinase, expression vector technology, applied in the field of genetic engineering, can solve the problems of increasing manpower, material resources, environmental pollution and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The cloning of implementation example 1Hv-LecRK gene
[0027] In the previous research of our laboratory, it was found that the Hv-CMPG gene played an important role in wheat powdery mildew resistance. In order to better study the mechanism of Hv-CMPG gene resistance to powdery mildew, yeast two-hybrid technology was used to use Hv-CMPG gene as bait , Screening yeast two-hybrid library to obtain Hv-LecRK gene. Primers P1: ATGGCCTTGGTCGTGTGCCCC (SEQ ID NO.3) and P2: TCATCTTCCACCTGAGATGTA (SEQ ID NO.4) were designed, and the Hv-LecRK gene was cloned using the cDNA of A. villosa 24 hours after being induced by Erysiphyllum as a template to obtain the full length of the Hv-LecRK gene. The sequence is SEQIDNO.1( figure 1 ).
Embodiment 2
[0028] Embodiment 2Hv-LecRK gene is subjected to the expression characteristic that powdery mildew induces
[0029] The high resistance to powdery mildew wheat strain 91C43 (number: PI368886, cited from the British Botanic Garden) (references: Qi Lili, Chen Peidu, etc., new resistance to powdery mildew in wheat - gene Pm21, Acta Crops, 1995, 21 (3 ): 257-262) sow in the petri dish to germinate, and transplant to the pot (surroundings are isolated with cylindrical transparent plastic sheets, and the top is closed with filter paper to form an environment without powdery mildew) after dew white. At the three-leaf stage, shake off the fresh spores of Nanjing local mixed powdery mildew cultured on the susceptible variety Sumai No. 3 on the seedlings of A. The leaves of T. villosa inoculated with powdery mildew were stored at 16°C. Samples were taken at 0h, 30min, 45min, 1h, 2h, 6h, 12h, 24h, 48h, and 72h after inoculation, and stored in a -70°C refrigerator for later use. TRIZOL ...
Embodiment 3
[0031] Embodiment 3Hv-LecRK sense expression vector construction
[0032] Utilizing the above-mentioned C. villosa cDNA induced by powdery mildew as a template, PCR was carried out with the primer pair P3 (CGGGATCCATGGCCTTGGTCGTGTGCC (SEQ ID NO.5)) and P4 (GGGGTACCTCATCCTCACCTGAGATG (SEQ ID NO.6)) capable of amplifying the Hv-LecRK gene protein coding region Amplify and recover the amplified fragment. Insert the amplified target fragment into the multiple cloning site BamHI behind the 35S promoter of the vector pBI220 (JeffersonRA, KavanaghTA, BevanMW.GUSfusions:beta-glucuronidaseassensitiveandversatilegenefusionmarkerinhigherplants.EMBOJ.1987,6:3901-3907) with BamHI and KpnI double digestion and KpnI. Thus the target gene Hv-LecRK is cloned to the downstream of the strong promoter 35S to obtain the expression vector pBI220:LecRK( image 3 ).
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 