Plasmid standard product for detecting HLA-DP gene rs3077 locus polymorphism and preparation method thereof
A locus polymorphism, standard technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of lack of positive standards, achieve high accuracy and reduce experimental errors , the effect of high purity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1 Designs the primers for amplifying the rs3077 site
[0034] Search the gene sequence of SNP rs3077 in the NCBI database. The base of this site is C in the wild type and T in the mutant type. The gene sequence near the SNP site is: TCTTCTCACTTCATGTGAAAACTAC[C / T]CCAGTGGCTGACTGAATTGCTGACC, see SEQ ID NO: 1 for the complete sequence , using the rs3077 gene sequence as a template, use Primer-BLAST to design primers, the target fragment size is 506bp, including the wild-type or mutant site to be detected, that is, the Y site in the sequence, and select primers with better specificity , the sequences of the forward and reverse primers are: 5′-AATAACTGTGTGTGTTGCTG-3′ and 5′-TCAATATCCTCAGACCTTTC-3′, the sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3 respectively, and then sent to Yingwei Jieji (Shanghai) Trade Co., Ltd. synthesized primers, and the synthetic primer dry powder was diluted to 5 pmol / μL with sterile deionized water, and set aside;
[0035] 10 DN...
Embodiment 2
[0038] Example 2 Screening of HLA-DP gene rs3077 site CC genotype TT genotype EDTA anticoagulated peripheral blood samples
[0039]Collection of peripheral blood: The blood samples used in the present invention are EDTA anticoagulated peripheral blood of healthy people. After informed consent of 10 subjects, they were collected in EDTA anticoagulant tubes, and each person collected 3 mL.
[0040] Extraction of peripheral blood genomic DNA: draw 500 μL each of the 10 collected peripheral blood samples, extract peripheral blood genomic DNA according to the operation instructions of the blood genomic DNA extraction kit (TIANGEN company, catalog number: DP318), and detect with ultra-trace nucleic acid protein The concentration and purity of the extracted nucleic acid were detected by a BioDrop instrument, and the extracted DNA samples were stored at -20°C for later use.
[0041] Amplification comparison: 10 samples of peripheral blood genomic DNA were amplified by PCR. The reactio...
Embodiment 3
[0042] Example 3 Construction of plasmid standards containing the CC and TT genotypes of the rs3077 site of the HLA-DP gene
[0043] 1. Extraction of CC type and TT type DNA and amplification of target fragments: the CC type and TT type blood samples screened out are subjected to DNA extraction and PCR amplification (extraction process and PCR amplification process are the same as in Example 2), Then carry out agarose gel electrophoresis, cut out the agarose gel containing the target fragment (506bp) in the gel imager operating table, then use the recovery purification kit (TIANGEN company) to recover and purify the agarose gel DNA fragment, Collect the purified product for later use.
[0044] ② Ligation and transformation: Ligate the purified product with pGM-T Vector, melt the vector on ice, and make a total reaction system of 10 μL: 3 μL target PCR fragment, 1 μL pGM-T Vector, 1 μL 10×T4 DNA Ligation Buffer, 1 μL T4DNA Ligase, 4 μL wxya 2 O, ligate overnight at 16°C; take...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap