Method for efficiently producing recombinant avian adeno-associated virus

A technology for recombining baculovirus and poultry gland, applied in biochemical equipment and methods, viruses, virus/bacteriophage, etc., to achieve the effect of easy to expand production, easy to expand use, and broad application prospects

Inactive Publication Date: 2016-11-09
王安平 +1
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

How to simultaneously express its functional proteins in insect cells? How to optimize the ratio of the three structural proteins of AAAV to improve the packaging efficiency of rAAAV? all to be studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently producing recombinant avian adeno-associated virus
  • Method for efficiently producing recombinant avian adeno-associated virus
  • Method for efficiently producing recombinant avian adeno-associated virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of the double-expression recombinant plasmid pFB-Rep containing AAAV functional protein gene Rep78 and Rep52 and preparation of recombinant baculovirus rBacRep

[0028] According to the gene sequence of AAAV-YZ strain (GeneBank accession number: GQ368252), two pairs of primers Rep78-F / R and Rep52-F / R were designed,

[0029] Rep78-F: 5'-CTAGCTAGCATGAGGTCGTACTACGAGGTC-'3 (SEQ ID No.1)

[0030] Rep78-R: 5'-CTAGCTAGCTCAGCCGCAGCGTTGACTCCC-'3 (SEQ ID No.2)

[0031]Rep52-F: 5′-CTAGTCGACATGGAGCTCGTGGATTGGCTC-′3 (SEQ ID No.3)

[0032] Rep52-R 5'-CTAGCGGCCGCTCAGCCGCAGCGTTGACTCCC-'3 (SEQ ID No.4)

[0033] The AAAV functional genes Rep78 and Rep52 were respectively amplified using pCR-AAAV (including the whole genome sequence of AAAV) as a template. The amplified Rep78 product was digested with Nhe I and inserted into the baculovirus transfer vector pFastBacDual to obtain the recombinant plasmid pFBDRep78. The amplified product of Rep52 was digested with S...

Embodiment 2

[0035] Example 2 Construction of recombinant plasmid pFB-VP containing 3 kinds of structural protein genes VP1, VP2 and VP3 of AAAV and preparation of recombinant baculovirus rBacVP

[0036] Design a pair of primers according to the gene sequence of AAAV-YZ strain (GeneBank accession number: GQ368252)

[0037] VP-F: 5′-CATGCGGCCGCCACGGCTCTTATTTCTGACGCGATACCCGATTGGTTG-′3 (italics indicate gene mutation site) (SEQ ID No.5)

[0038] VP-R: 5'-CGTAAGCTTTTACAGCGGTTTGGTGAGGTAACGGGTACCG-'3 (SEQ ID No.6), the open reading frame of AAAV structural gene VP was amplified using pCR-AAAV (containing the whole genome sequence of AAAV) as a template. The obtained PCR product was digested with NotI and HindIII enzymes and inserted into the baculovirus transfer vector pFastBac1, and the obtained recombinant plasmid was named pFB-VP. DH10Bac was transformed, and the recombinant bacmid rBacmid-VP was obtained through resistance and blue-white screening and PCR identification. The bacmid was pur...

Embodiment 3

[0040] Example 3 Construction of the green fluorescent protein reporter gene transfer vector pFB-ITRGFP regulated by the giant cell CMV promoter and preparation of recombinant baculovirus rBacGFP

[0041] In order to remove the EcoRI site at the multiple cloning site of pEGFP-N1, the recombinant plasmid obtained was used as a template after digestion with HindIII and SacII to fill in the blunt connection, and GGAGTCGACTAGTTATTAATAGTAATC (SEQ ID No. 7) / GCAACGCGTCTTAAGATACATTGATG (SEQ ID No. 8) Amplify the GFP expression frame with primers, insert pCR-AAAV into the vector fragment after PmlⅠ and BsmBI enzyme digestion and make up, obtain the recombinant plasmid pCRITRGFP, and use EcoRI enzyme digestion pCRITRGFP to recover the fragment containing ITR and GFP expression cassette on both sides , into the baculovirus transfer vector pFastBac1 to obtain the recombinant plasmid pFB-ITRGFP. DH10Bac was transformed, and the recombinant bacmid rBacmid-GFP was obtained through resistance...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for efficiently producing recombinant avian adeno-associated virus. The method comprises the steps of first respectively constructing recombinant baculovirus rBacRep for expressing functional protein genes Rep78 and Rep52 of avian adeno-associated virus (AAAV), recombinant baculovirus rBacVP for expressing three structural protein genes VP1, VP2 and VP3 of the AAAV and recombinant baculovirus rBacGFP for expressing green fluorescence protein reporter genes; infecting insect cells Sf9 with the rBacRep, the rBacVP and the rBacGFP simultaneously, and obtaining rAAAV-GFP. According to fluorescent quantitative polymerase chain reaction (PCR) detection, each Sf9 cell can generate about 28000 VG of rAAAV-GFP, and the yield is improved by about 20 times compared with a conventional three-plasmid method. The method not only is simple and convenient in operation procedure and greatly improves virus titer, but also is easy to produce in a large scale, and the bottleneck of using rAAAV as a novel virus gene transfer vector is overcome.

Description

technical field [0001] A method for efficiently producing recombinant adeno-associated virus, which is used for the production and application of recombinant adeno-associated virus, belongs to the field of biological products. The invention relates to a recombinant AAAV (avian adeno-associated virus) vector and a preparation method of the virus vector. Background technique [0002] Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the family Parvoviridae and is a single-stranded DNA virus with replication defects. Recombinant adeno-associated virus is currently recognized as one of the most promising gene transfer vectors. It has the advantages of no pathogenicity to the host, extremely low immunogenicity, and a wide range of hosts. Therefore, it is widely used in gene therapy and genetic engineering vaccines, etc. Some studies have entered human clinical trials. The preparation method of recombinant adeno-associated virus is mainly the three-pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/866
CPCC07K14/43595C12N7/00C12N15/86C12N2710/14043C12N2750/14121C12N2750/14151C12N2800/107
Inventor王安平朱善元王永娟左伟勇吴双郭长明秦枫洪伟鸣
Owner王安平