Unlock instant, AI-driven research and patent intelligence for your innovation.

Synthetic method of lipopeptide based on pseudomonas chlororaphis

A technology of Pseudomonas chloropinus and synthetic methods, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve problems that are not clearly given

Active Publication Date: 2017-03-01
SHANGHAI JIAO TONG UNIV
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although Shanghai Jiaotong University has disclosed the identification and function of lipopeptides in a biocontrol Pseudomonas chloropina HT66 (Xiong Xin et al.), this technical solution only discloses that the biocontrol Pseudomonas chloropina HT66 can It is used for the synthesis of peptide lipids, but the practical application issues such as how to obtain higher yields of peptide lipids and how to obtain peptide lipids in the shortest time are not clearly given in this document, so it only provides a qualitative description. For practical application, it is urgent to develop a specific peptide synthesis method based on the biocontrol of Pseudomonas chloropsis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Synthetic method of lipopeptide based on pseudomonas chlororaphis
  • Synthetic method of lipopeptide based on pseudomonas chlororaphis
  • Synthetic method of lipopeptide based on pseudomonas chlororaphis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cluster analysis of lipopeptide synthetic proteins

[0034]Select the lipopeptide synthesis protein sequence of Pseudomonas chloropinus HT66 and the lipopeptide synthesis protein sequence of known structure in other Pseudomonas, conduct module analysis, and construct a phylogenetic tree; according to the homology and The position determines the corresponding amino acid and its sequence. For protein sequence determination, refer to literature (Gross H, Stockwell VO, Henkels MD, et al. The genomisotopic approach: a systematic method to isolate products of orphan biosynthetic gene clusters [J]. Chemistry & Biology, 2007, 14(1): 53-63) .

[0035] Protein sequence analysis found that the lipopeptide synthesis protein of strain HT66 contained 9 modules, indicating that the lipopeptide product was composed of 9 amino acids. From the NCBI database, the inventor found 4 strains of Pseudomonas that can synthesize lipopeptides and whose molecular structure has been ...

Embodiment 2

[0039] Example 2: Construction of lipopeptide synthesis gene cluster deletion strain

[0040] Primers were designed based on the whole genome sequence of strain HT66. The primer pair (5'-3') for amplifying the upstream homology arm of the lipopeptide synthesis gene cluster clp is:

[0041] clp-F1 (SEQ ID NO. 1): CG GAATTC AGCATCTTCGCCGCAAACAG (EcoRI),

[0042] clp-R1 (SEQ ID NO. 2): CCGGGATGAATGGGTAGTCG;

[0043] The primer pair for amplifying the downstream homology arm of clp is:

[0044] clp-F2 (SEQ ID NO. 3): ACTACCCATTCATCCCGGCGGGCTATGGATGGGTTCG,

[0045] clp-R2 (SEQ ID NO. 4): C GGATCC TGGAGATCGCCGCGTCTTC (BamHI).

[0046] The PCR system and procedures were carried out with reference to the literature (Gross H, Stockwell VO, Henkels MD, et al.Thegenomisotopic approach: a systematic method to isolate products of orphanbiosynthetic gene clusters[J].Chemistry&Biology,2007,14(1):53-63) . Genomic DNA extraction, plasmid extraction, electrophoresis gel fragment rec...

Embodiment 3

[0048] Embodiment 3: the mass spectrometry analysis of lipopeptide product

[0049] The strains HT66 and HT66Δclp were fermented in KB medium respectively, and the lipopeptide products were extracted from the 24h fermentation broth using chloroform-methanol (2:1) solution, and the organic phase was taken and dried with nitrogen (Smyth T, Rudden M, Tsaousi K, et al. Protocols for the isolation and analysis of lipopeptides and bioemulsifiers [M]. New York; Humana Press. 2014:1-26). The crude extract was dissolved in acetonitrile, filtered and detected by ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC / QTOF-MS). The instrument is WatersACQUITYTM UPLC&Q-TOF MS Premier. The chromatographic column is Waters CORTECS 1.6μm (2.1mm×100mm), the column temperature is 45°C, the injection volume is 1μL, the flow rate is 0.4mL / min, the detection wavelength is 254nm and 210nm; the gradient elution conditions are: 0min, water 95 %, acetonitril...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a synthetic method of lipopeptide based on pseudomonas chlororaphis. The method specifically comprises the following steps: pseudomonas chlororaphis undergoes fermental cultivation to obtain a fermentation broth containing peptidolipid. The conditions of the fermental cultivation are as follows: 25-30 DEG C; 200-300 r / min; and 25-50 mL / 250 mL of loading sample volume. In allusion to defects of the prior art, according to the corresponding relationship between fermentation temperature, rotating speed, loading sample volume and lipopeptide yield, practical application problems, such as how to obtain high-yield lipopeptide and how to obtain lipopeptide within a short period of time, are solved; and finally, lipopeptide yield is remarkably enhanced.

Description

technical field [0001] The invention relates to a method for synthesizing lipopeptides based on Pseudomonas chloropinus. Background technique [0002] Lipopeptide (LP) is a biosurfactant synthesized by microorganisms such as Pseudomonas and Bacillus, which can affect cell growth, movement, biofilm synthesis and other functions. , bacteria, fungi and oomycetes have broad-spectrum antagonistic effects and have important potential for pharmaceutical development. Among them, Daptomycin (Daptomycin) synthesized by Streptomyces roseospora is the first commercial lipopeptide antibiotic, which has good antibacterial effect on Gram-positive pathogens including some drug-resistant bacteria, and can inhibit staphylococcus, Enterococcus growth and reproduction, its curative effect and safety are good. [0003] The structure of lipopeptides has significant diversity. In addition to the number, type and ring-forming position of amino acids, the length of the fatty acid chains is also di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P21/00C12R1/38
CPCC12P21/00
Inventor 彭华松张雪洪熊欣侯博文
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More