Unlock instant, AI-driven research and patent intelligence for your innovation.

Toxoplasma gondii tandem multi-epitope gene ELISA detection kit

A detection kit, a technology for Toxoplasma gondii, applied in measurement devices, instruments, scientific instruments, etc., can solve the problem that the sensitivity, specificity and repeatability of detection are not ideal, ELISA plates cannot effectively detect antibodies, and there is a lack of clinical rapid diagnosis methods. and other problems, to reduce the low detection efficiency, improve the sensitivity and specificity, and achieve the effect of strong specificity

Inactive Publication Date: 2017-04-05
吉林省畜牧兽医科学研究院
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Different types of detection kits developed in China have been applied to a certain extent in human and animal epidemiological investigations and disease diagnosis, but the sensitivity, specificity and repeatability of detection are still not ideal. The composite rate is only about 60%, and there is a lack of clinical rapid diagnosis methods
Due to the wide host range and complex life history of Toxoplasma gondii, the ELISA plate coated with a single antigen cannot effectively detect antibodies, and there are false positives and false negatives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Toxoplasma gondii tandem multi-epitope gene ELISA detection kit
  • Toxoplasma gondii tandem multi-epitope gene ELISA detection kit
  • Toxoplasma gondii tandem multi-epitope gene ELISA detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Cloning of embodiment 1 Toxoplasma gondii MIC1, MAG1, SAG1 gene

[0038] According to the sequences of Toxoplasma gondii MIC1, MAG1 and SAG1 in GenBank, specific primers were designed as follows:

[0039] 1. MIC1

[0040] -F: GGATCCGCGTCGCATTCTCATTCG BamH I, 24bp, 18, GC% 58.3, Tm 74.2

[0041] -R:GAATTCGGCCTTCTCGTAACACCTCC EcoR I,,26bp, GC%53.8, Tm 69.5

[0042] 2. MAG1

[0043] -F:GAATTCAGCCAAAGGGTGCCAGAG EcoR I ,24bp, GC%54.2, Tm 69.0

[0044] -R:AAGCTTAGATCCCTGAACCCTTAGAATATACAC Hind III, 33bp, GC% 39.4, Tm 65.5

[0045] 3. SAG1

[0046] -F: AAGCTTGATCCCCCTCTTGTTGCC Hind III, 24bp, GC%54.2, Tm69.4

[0047] -R:CTCGAGAAGAGTGCTGTCTGCACCGT Xho I , 26bp, GC%57.7, Tm 71.1

[0048] The MIC1, MAG1, and SAG1 genes of Toxoplasma gondii were amplified by RT-PCR technology, and the reaction system was as follows:

[0049] RT reaction system:

[0050]

[0051] 60min at 42°C, 5min at 95°C, 1-5min at 4°C.

[0052] PCR reaction system:

[0053]

[0054] 95°C for 5m...

Embodiment 2

[0058] Example 2 Expression and purification of tandem MIC1, MAG1, SAG1 gene proteins

[0059] Connect the multi-epitope gene to the prokaryotic expression vector pET-28a, use DE3 competent cells to transform into Escherichia coli, inoculate the positive recombinant bacteria in 50ml of LB culture medium at a ratio of 1:100, and incubate at 37°C for 200r / min, after 3h, the expression was induced by IPTG with a final concentration of 1mM, and the gene expression was analyzed by SDS-PAGE and Western blotting. Such as figure 1 , figure 2 shown, as expected. Then a large amount of recombinant protein was produced, and the collected bacteria were ultrasonically broken and centrifuged at 12000 g for 10 min, and the lysed supernatant was used to purify the recombinant protein on a nickel column. According to Sangon Bioengineering (Shanghai) Co., Ltd. Ni-NTA-Sefinose Column instructions, the expressed protein was purified to obtain the purified protein of ideal concentration, such...

Embodiment 3

[0060] Example 3 Establishment of indirect ELISA method

[0061] 1. The establishment of the reaction program:

[0062] Coating: The tandem MIC1, MAG1, SAG1 gene expression purified protein was diluted to 10 μg / ml with pH 9.6 carbonic acid buffer, added to the microtiter plate at 100 μL per well, and left overnight at 4°C. Dry the coating solution, wash the plate 3 times with PBST (PBS containing 0.05% Tween-20, pH 7.2), 200 μL / well, 5 min / time. Blocking: add 5% skimmed milk blocking solution, 200 μL / well, 37°C for 60 minutes, spin dry, wash with washing solution 3 times. Add the serum to be tested: after diluting the serum to be tested in proportion, add 100 μL to each well and react at 37°C for 60 minutes; wash with washing solution for 3 times. Add enzyme-labeled secondary antibody: add HRP-labeled rabbit anti-goat secondary antibody, 100 μL per well, react at 37°C for 45 minutes; shake off the liquid and wash the plate. Color development: add TMB substrate solution, 10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Toxoplasma gondii tandem multi-epitope gene ELISA detection kit. The kit is characterized in that serum to be detected is diluted with a sample, 100 [mu]l of the diluted serum to be detected is added to a 96-well ELISA plate<(1)> and is incubated for at 37 DEG C for 1 h, and positive control, negative control and blank control are arranged; the incubated serum to be detected is washed with a washing liquid for 3 min every time and is washed 5 times; a rabbit anti-sheep IgG-HRP conjugate is added, and acts at 37 DEG C for 1 h, the obtained material is washed with the washing liquid for 3 min every time and is washed 5 times; and a chromogenic substrate solution is added, a substrate A and a substrate B are mixed according to a ratio of 1:1, 100 [mu]l of the obtained substrate mixture is added to the ELISA wells, shady coloration is carried out for 15 min, 50 [mu]l of a stopping solution is added, and the OD490 value is detected; and the inhibition rate PI = (OD negative control - OD sample) / OD negative control * 100%, the sample is positive if the PI is not less than 50%, and the sample is negative if the PI is less than 50%. The kit has the advantages of mature method, high repeatability, and effective reduction of false positivity and non-repeatability in the detection of the Toxoplasma gondii, and can be operated by general researchers.

Description

technical field [0001] The present invention relates to a new type of toxoplasma detection kit, in particular to a toxoplasma tandem multi-epitope gene ELISA detection kit, which can improve the detection efficiency, and belongs to a new diagnostic reagent for animal epidemics, which is used in animal husbandry Medical field. [0002] Background technique: [0003] Toxoplasmosis is a zoonotic protozoan disease caused by Toxoplasma gondii. At least 1 / 3 of the world's population is infected with Toxoplasma gondii. There are many types of cells invaded by Toxoplasma gondii, and a wide range of accumulated organs. Coupled with individual differences, the clinical manifestations are very different. Toxoplasmosis outbreaks in pigs, the fatality rate can be as high as 60%. The prevalence of toxoplasmosis in livestock and poultry, on the one hand, causes major economic losses to animal husbandry due to abortion or death, and seriously affects the development of animal husbandry; ....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/543
CPCG01N33/54393G01N2333/45Y02A50/30
Inventor 曹利利姚新华董航郭衍冰苑淑贤
Owner 吉林省畜牧兽医科学研究院