Toxoplasma gondii tandem multi-epitope gene ELISA detection kit
A detection kit, a technology for Toxoplasma gondii, applied in measurement devices, instruments, scientific instruments, etc., can solve the problem that the sensitivity, specificity and repeatability of detection are not ideal, ELISA plates cannot effectively detect antibodies, and there is a lack of clinical rapid diagnosis methods. and other problems, to reduce the low detection efficiency, improve the sensitivity and specificity, and achieve the effect of strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Cloning of embodiment 1 Toxoplasma gondii MIC1, MAG1, SAG1 gene
[0038] According to the sequences of Toxoplasma gondii MIC1, MAG1 and SAG1 in GenBank, specific primers were designed as follows:
[0039] 1. MIC1
[0040] -F: GGATCCGCGTCGCATTCTCATTCG BamH I, 24bp, 18, GC% 58.3, Tm 74.2
[0041] -R:GAATTCGGCCTTCTCGTAACACCTCC EcoR I,,26bp, GC%53.8, Tm 69.5
[0042] 2. MAG1
[0043] -F:GAATTCAGCCAAAGGGTGCCAGAG EcoR I ,24bp, GC%54.2, Tm 69.0
[0044] -R:AAGCTTAGATCCCTGAACCCTTAGAATATACAC Hind III, 33bp, GC% 39.4, Tm 65.5
[0045] 3. SAG1
[0046] -F: AAGCTTGATCCCCCTCTTGTTGCC Hind III, 24bp, GC%54.2, Tm69.4
[0047] -R:CTCGAGAAGAGTGCTGTCTGCACCGT Xho I , 26bp, GC%57.7, Tm 71.1
[0048] The MIC1, MAG1, and SAG1 genes of Toxoplasma gondii were amplified by RT-PCR technology, and the reaction system was as follows:
[0049] RT reaction system:
[0050]
[0051] 60min at 42°C, 5min at 95°C, 1-5min at 4°C.
[0052] PCR reaction system:
[0053]
[0054] 95°C for 5m...
Embodiment 2
[0058] Example 2 Expression and purification of tandem MIC1, MAG1, SAG1 gene proteins
[0059] Connect the multi-epitope gene to the prokaryotic expression vector pET-28a, use DE3 competent cells to transform into Escherichia coli, inoculate the positive recombinant bacteria in 50ml of LB culture medium at a ratio of 1:100, and incubate at 37°C for 200r / min, after 3h, the expression was induced by IPTG with a final concentration of 1mM, and the gene expression was analyzed by SDS-PAGE and Western blotting. Such as figure 1 , figure 2 shown, as expected. Then a large amount of recombinant protein was produced, and the collected bacteria were ultrasonically broken and centrifuged at 12000 g for 10 min, and the lysed supernatant was used to purify the recombinant protein on a nickel column. According to Sangon Bioengineering (Shanghai) Co., Ltd. Ni-NTA-Sefinose Column instructions, the expressed protein was purified to obtain the purified protein of ideal concentration, such...
Embodiment 3
[0060] Example 3 Establishment of indirect ELISA method
[0061] 1. The establishment of the reaction program:
[0062] Coating: The tandem MIC1, MAG1, SAG1 gene expression purified protein was diluted to 10 μg / ml with pH 9.6 carbonic acid buffer, added to the microtiter plate at 100 μL per well, and left overnight at 4°C. Dry the coating solution, wash the plate 3 times with PBST (PBS containing 0.05% Tween-20, pH 7.2), 200 μL / well, 5 min / time. Blocking: add 5% skimmed milk blocking solution, 200 μL / well, 37°C for 60 minutes, spin dry, wash with washing solution 3 times. Add the serum to be tested: after diluting the serum to be tested in proportion, add 100 μL to each well and react at 37°C for 60 minutes; wash with washing solution for 3 times. Add enzyme-labeled secondary antibody: add HRP-labeled rabbit anti-goat secondary antibody, 100 μL per well, react at 37°C for 45 minutes; shake off the liquid and wash the plate. Color development: add TMB substrate solution, 10...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com