Method and enzyme for preparing 3 alpha-hydroxyl-7-oxo-5 beta-cholanic acid
A cholanoic acid and deoxycholic acid technology, which is applied in biochemical equipment and methods, oxidoreductases, enzymes, etc., can solve the problems of harsh conditions, long reaction time, polluted environment, etc., and achieves mild and easily controllable reaction conditions, The effect of high industrial application value, non-toxic and non-polluting cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0029] Preparation of co-expression recombinant plasmid pET22b-AH2-LDH containing parental genes
[0030] will be derived from Brucella melis ( Brucella melitensis ) of the 7α-steroid dehydrogenase gene AH2 and from Weissella ( Weissella The lactate dehydrogenase gene LDH of sp) uses the primer pair 5'CGCCATATGATGGGCGCCGACCCGGTTTA3' and 5'CCGGAATTCTCAGTCGAGTTCCTGCACGCC3' and the primer pair 5'CCGGAATTCAAGGAGATATACATATGAAGATCTTCGCGTACGGTA3' and 5'CCGCTCGAGTTAATATTCCACCGCAATGC3' respectively to obtain the PCR product through PCR amplification technology, and then undergo enzyme digestion into the expression vector pET22b(+) Nde I and Eco R I site and Eco R I site and xhoI site, the co-expression recombinant plasmid pET22b-AH2-LDH was obtained. Through DNA sequencing, it is determined that the nucleotide sequence of the cloned parent 7α-steroid dehydrogenase is shown in SEQ ID NO: 1, and its amino acid sequence is shown in SEQ ID NO: 2; it is determined that the clone...
Embodiment 2
[0032] Preparation of co-expression recombinant plasmids containing 7α-steroid dehydrogenase mutants
[0033] Perform site-directed mutation on the 7α-steroid dehydrogenase parent by reverse PCR technology, design reverse primers at the mutation position, use upstream and downstream mutation primers to amplify the target fragment, and introduce corresponding mutations on the primers to recombine plasmid pET22b-AH2 -LDH was used as a template for inverse PCR, and the PCR product was Dpn I enzyme digested the template and transformed it into Escherichia coli Rosetta (de3). After screening by Amp, colonies were picked and sent for sequencing. The mutation sites and primer design are shown in Table 1.
[0034] The PCR system is: TaKaRa EX Taq HS 0.25ul; 10×Ex Taq Buffer 5ul; template plasmid 1ul; dNTP (2.5mM each) 4ul; upstream primer 1ul; downstream primer 1ul; sterile water up to 50ul.
[0035] The PCR program is: first 98°C for 2min; then 98°C for 10s, 55-56°C for 30s, 72°C...
Embodiment 3
[0038] Preparation of enzyme solution
[0039] The parent and mutant co-expression recombinant plasmids prepared in Example 1 and Example 2 were respectively transferred into Escherichia coli Rosetta (de3), and then the recombinant Escherichia coli was inoculated in a small volume of LB medium (containing 100 μg / mL of Amp ), after culturing overnight at 30-37°C, transfer it to a certain volume of LB medium (containing 100 μg / mL Amp) at an inoculum size of 1-5%, and continue culturing OD at 30-37°C 600 After reaching 0.6-1.0, add isopropyl-β-D-thiogalactoside (IPTG) at a final concentration of 0.1 mM-1 mM, induce expression at 20-37° C. for 10-20 hours, and then collect the bacteria by centrifugation. The fermented bacteria are suspended in a certain volume of 50-100mM potassium phosphate buffer (pH8.0), and the cells are broken by ultrasonic waves, and centrifuged to obtain the parent product containing lactate dehydrogenase and 7α-steroid dehydrogenase or dehydrogenated with ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap