A recombinant Torulopsis glabrata co-producing pyruvate and α-ketoglutarate
A technology of T. glabrata and ketoglutaric acid is applied in the field of fermentation engineering to achieve the effect of shortening production cycle and improving production intensity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Amplification of Saccharomyces cerevisiae CDC19 and construction of expression plasmid
[0030] Using the S. cerevisiae S288c genome as a template, the target gene CDC19 fragment was amplified by PCR, and a specific fragment of about 1500 bp was obtained by agarose gel electrophoresis. After the target gene CDC19 was digested with restriction enzymes Pac I and Not I, After concentration and purification, the CDC19 gene was cloned into the expression plasmid pY26-TEF-GPD to obtain the recombinant yeast expression plasmid pY26-CDC19. The recombinant expression plasmid was transformed into the competent cell JM109 and spread on the LB plate containing ampicillin. The PCF primers are as follows:
[0031] CDC19(F)-1: TCCCCCGGGATGTCTAGATTAGAAAGATTGACCTCATTA
[0032] CDC19(R)-1: CCCAAGCTTTTAAACGGTAGAGACTTGCAAAGTG
Embodiment 2
[0033] Example 2: Construction and identification of recombinant bacteria
[0034] Since the above recombinant plasmid pY26-CDC19 contains the Ura3 gene, the recombinant yeast plasmid pY26-CDC19) was transformed into the recipient bacteria TgU by electric shock. - (That is, T.glabrata CCTCC M202019 with the Ura gene deleted), the recombinant bacteria TgU that grows normally on the basal medium without uracil is obtained - (pY26-CDC19).
Embodiment 3
[0035] Example 3: Control fermentation experiment of recombinant bacteria and control bacteria
[0036] Pick the recombinant strain TgU - (pY26-CDC19) and TgU containing empty plasmid pY26-TEF-GPD, and Yarrowia lipolytica WSH-Z06 - (As a control bacteria) single colonies were activated and cultured on the seed medium for 18-24 hours, and the above-mentioned activated and cultured seed liquid was inoculated into the fermentation medium at an inoculum of 5-10% (volume ratio). ℃, 400-600rpm conditions for fermentation culture. The fermentation results are shown in Table 1. Compared with the control bacteria TgU - (pY26-TEF-GPD), total acid production (pyruvic acid and α-ketoglutarate), total acid conversion rate and total acid production intensity increased by 112.2%, 115.6% and 155.6% respectively. The most important is the recombinant bacteria TgU - The production of α-ketoglutarate of (pY26-CDC19) has increased from 0 g / L before the transformation to 30.1 g / L. Compared with Yarr...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com