Check patentability & draft patents in minutes with Patsnap Eureka AI!

A recombinant Torulopsis glabrata co-producing pyruvate and α-ketoglutarate

A technology of T. glabrata and ketoglutaric acid is applied in the field of fermentation engineering to achieve the effect of shortening production cycle and improving production intensity

Active Publication Date: 2019-11-26
JIANGNAN UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the co-production fermentation of the two ketoacids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant Torulopsis glabrata co-producing pyruvate and α-ketoglutarate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Amplification of Saccharomyces cerevisiae CDC19 and construction of expression plasmid

[0030] Using the S. cerevisiae S288c genome as a template, the target gene CDC19 fragment was amplified by PCR, and a specific fragment of about 1500 bp was obtained by agarose gel electrophoresis. After the target gene CDC19 was digested with restriction enzymes Pac I and Not I, After concentration and purification, the CDC19 gene was cloned into the expression plasmid pY26-TEF-GPD to obtain the recombinant yeast expression plasmid pY26-CDC19. The recombinant expression plasmid was transformed into the competent cell JM109 and spread on the LB plate containing ampicillin. The PCF primers are as follows:

[0031] CDC19(F)-1: TCCCCCGGGATGTCTAGATTAGAAAGATTGACCTCATTA

[0032] CDC19(R)-1: CCCAAGCTTTTAAACGGTAGAGACTTGCAAAGTG

Embodiment 2

[0033] Example 2: Construction and identification of recombinant bacteria

[0034] Since the above recombinant plasmid pY26-CDC19 contains the Ura3 gene, the recombinant yeast plasmid pY26-CDC19) was transformed into the recipient bacteria TgU by electric shock. - (That is, T.glabrata CCTCC M202019 with the Ura gene deleted), the recombinant bacteria TgU that grows normally on the basal medium without uracil is obtained - (pY26-CDC19).

Embodiment 3

[0035] Example 3: Control fermentation experiment of recombinant bacteria and control bacteria

[0036] Pick the recombinant strain TgU - (pY26-CDC19) and TgU containing empty plasmid pY26-TEF-GPD, and Yarrowia lipolytica WSH-Z06 - (As a control bacteria) single colonies were activated and cultured on the seed medium for 18-24 hours, and the above-mentioned activated and cultured seed liquid was inoculated into the fermentation medium at an inoculum of 5-10% (volume ratio). ℃, 400-600rpm conditions for fermentation culture. The fermentation results are shown in Table 1. Compared with the control bacteria TgU - (pY26-TEF-GPD), total acid production (pyruvic acid and α-ketoglutarate), total acid conversion rate and total acid production intensity increased by 112.2%, 115.6% and 155.6% respectively. The most important is the recombinant bacteria TgU - The production of α-ketoglutarate of (pY26-CDC19) has increased from 0 g / L before the transformation to 30.1 g / L. Compared with Yarr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant torulopsis glabrata capable of co-producing pyruvic acid and alpha-ketoglutaric acid, and belongs to the technical field of fermentation engineering. Through a gene engineering technique, CDC19 originated from brewer's yeast is integrated into a pY26-TEF-GPD expression vector to establish brewer's yeast recombinant expression plasmid pY26-CDC19, and then the recombinant expression plasmid pY26-CDC19 is electrotransformed into a recipient bacterium TgU- to obtain an engineering strain TgU-(pY26-CDC19) with a high yield of pyruvic acid. Compared with control bacteria, the total acid yield (pyruvic acid and alpha-ketoglutaric acid), the total acid conversion rate, and the total acid production intensity are improved by 112.2%, 115.6%, and 155.6%. Most importantly, the output of alpha-ketoglutaric acid of the recombinant bacterium TgU-(pY26-CDC19) is increased from 0 g / L to 30.1 g / L after modification.

Description

Technical field [0001] The invention relates to a recombinant S. glabrata for co-producing pyruvate and α-ketoglutarate, and belongs to the technical field of fermentation engineering. Background technique [0002] Keto acids are compounds containing both carboxyl and keto groups in the molecule. According to the relative positions of the carboxyl and ketone groups in the molecule, they can be divided into α and β-keto acids. They are a kind of organic acids that play an important role in the living body. At the same time, the demand for them in the society is increasing. They are widely used Daily chemical, food, medical, agriculture and other industries. Among them, α keto acid is a keto acid with a carboxyl group on the α carbon atom, and pyruvate is the simplest α keto acid. As an intermediate product of biological metabolism, pyruvate is in the middle of various metabolic pathways and is the final product of glycolysis; it is converted into acetyl-CoA, the starting materia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/19C12P7/40C12P7/50C12R1/645
CPCC07K14/39C12N9/1205C12P7/40C12P7/50C12Y207/0104
Inventor 周景文陈坚罗正山堵国成刘松方芳
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More