Genetic engineering strain for producing DHHA (2,3-dihydro-3-hydroxyanthranilic acid) and application thereof

A genetically engineered strain and gene technology, applied in the field of bioengineering, can solve the problems of complex metabolites and difficulties in strain transformation, and achieve the effects of simple and easy fermentation, easy separation and extraction, and environmental friendliness

Inactive Publication Date: 2017-05-31
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to overcome the problems of strain stability, complex metabolites, and difficult strain transformation in the above-mentioned technologies, and provide a genetically engineered strain for producing DHHA and its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain for producing DHHA (2,3-dihydro-3-hydroxyanthranilic acid) and application thereof
  • Genetic engineering strain for producing DHHA (2,3-dihydro-3-hydroxyanthranilic acid) and application thereof
  • Genetic engineering strain for producing DHHA (2,3-dihydro-3-hydroxyanthranilic acid) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Construction of pK18FF plasmid and construction of HT66ΔphzF mutant strain

[0050] Such as figure 1 As shown, select upstream 500bp (SEQ ID NO.3) and downstream fragments of about 1000bp (SEQ ID NO.4) on the upstream and downstream of the phzF gene, and design primers. The upstream fragment primer R1 (SEQ ID NO.5) and the downstream fragment primer F2 (SEQID NO.8) was respectively added in reverse complementarity to the opposite primer sequence, so as to facilitate the experiment of Overlap PCR. The upstream and downstream fragments were respectively amplified, and after purification and recovery, the upstream and downstream fragments were used as templates, and F1 (SEQ ID NO.7) and R2 (SEQ ID NO.6) were used as primers for Overlap PCR to obtain fusion fragments.

[0051] The successfully constructed FF fusion fragment and pk18mobsacB were subjected to double enzyme digestion, and the digested products were recovered and ligated. The ligated products were...

Embodiment 2

[0053] Example 2. Mutation knockout of phzF gene and construction of HT66ΔphzF mutant strain

[0054] 2.1 Construction of phzF gene in vitro mutation plasmid

[0055] Design primers phzF1 / phzF2 (SEQ ID NO.11, SEQ ID NO.12), the underlined nucleotides are restriction endonuclease Hind III and Sac I restriction sites, amplify the phzF gene fragment using the HT66 genome as a template , 1.6kb, annealing temperature 55 ℃. Using the plasmid pBS(Kan) as a template, primers pBS-Kan-R / pBS-Kan-F were designed to amplify the 1.0 kb Kanar resistance gene Kan, and the annealing temperature was 50°C.

[0056] phzF1: 5′TT AAGCTT CGGCAAGGACTACGAGGACA 3' (SEQ ID NO. 11)

[0057] phzF2: 5′AA GAGCTC CCGCCAGTACCTGAACATCAC 3' (SEQ ID NO. 12)

[0058] 2.2 Double enzyme digestion of pEX18Tc plasmid and phzF fragment

[0059] Both the double-digestion and single-digestion reactions were carried out according to the enzyme digestion system and reaction conditions provided by TAKARA.

[00...

Embodiment 3

[0113] Embodiment 3, the detection of fermentation product

[0114] Due to the high polarity of DHHA, it cannot be extracted by ethyl acetate, so the bacterial fermentation broth was filtered with 0.22 μm microporous filter paper, and then directly detected by HPLC. The HPLC instrument is Agilent 1260, phenyl column, detection wavelength 278nm, injection volume 20 μL, mobile phase 0.1% formic acid aqueous solution and methanol, gradient elution detection, the gradient is shown in Table 4 below.

[0115] Table 4

[0116] time 0.1% formic acid aqueous solution: methanol 0-6min 85∶15 7min 50∶50 17min 10∶90 18-21min 85∶15

[0117] The detection results of HT66WT and HT66ΔphzF fermentation products under different conditions are as follows: Figure 4 shown by Figure 4 It can be seen that under the detection conditions of phenazine compounds (C18 reverse column, 254nm, Figure 4 -A), phenazine-1-carboxamide was not detected in the HT66Δ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic engineering strain for producing DHHA (2,3-dihydro-3-hydroxyanthranilic acid) and the application thereof. On the basis of pseudomonas chlororaphis HT66 CCTCC NO: M2013467 secreting phenazinyl-1-carboxamide, a gene phzF in genomes of the strain and derivatives thereof is knocked out in the phenazine synthesizing route, so that an intermediate metabolite DHHA is accumulated and a phenazine compound is not synthesized any more. The genetic engineering strain can be applied to the preparation of the DHHA. The DHHA can be used as an important organic synthetic intermediate and a chiral catalyst, and has an important application value. The genetic engineering strain is safe, reliable, good in stability and short in fermentation period, and is conducive to biosynthesis and industrial application of the DHHA.

Description

technical field [0001] The invention belongs to the field of bioengineering, in particular to a genetically engineered bacterial strain for producing 2,3-dihydro-3-hydroxyanthranilic acid (2,3-dihydro-3-hydroxyanthranilic acid, DHHA for short) and its use . Background technique [0002] 2,3-dihydro-3-hydroxyanthranilic acid (Trans-2,3-dihydro-3-hydroxyanthranilicacid, DHHA), also known as (5S,6S)-6-amino-5-hydroxyl-1,5- Cyclohexadienecarboxylic acid ((5S,6S)-6-amino-5-hydroxy-cyclohexa-1,5-dienecarboxylic acid, 2,3-trans-CHA), CAS number 38127-17-2, molecular formula C 7 h 9 NO 3 , is an important intermediate metabolite synthesized through the chorismate pathway. . [0003] In 1962, by McCormick et al [McCormick JRD, Reichenthal J, Hirsch U, et al. (+) trans-2,3-DIHYDRO-3-HYDROXYANTHRANILIC ACID.A NEW AMINO ACID PRODUCED BYStreptomyces aureofaciens[J].Journal of the American Chemical Society, 1961,83 (19): 4104-4105.] It was isolated from a low-yielding tetracycline m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/00C12R1/38
Inventor彭华松张雪洪侯博文
OwnerSHANGHAI JIAO TONG UNIV