Method for preparing alpha-ketoisovaleric acid and isobutanol by adopting klebsiella pneumoniae

A technology of Kneumococcus pneumoniae and ketoisovaleric acid, applied in the field of bioengineering, can solve problems such as undiscovered, and achieve the effect of wide range of raw materials, high genetic stability, and high final concentration of products

Active Publication Date: 2017-06-20
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

No published reports were found on the production of α-ketoisovaleric acid and isobutanol by Klebsiella pneumoniae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing alpha-ketoisovaleric acid and isobutanol by adopting klebsiella pneumoniae
  • Method for preparing alpha-ketoisovaleric acid and isobutanol by adopting klebsiella pneumoniae
  • Method for preparing alpha-ketoisovaleric acid and isobutanol by adopting klebsiella pneumoniae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The acetolactate decarboxylase gene of Klebsiella pneumoniae CGMCC 1.6366 strain (the strain is also called TUAC01, AC01) is inactivated by gene recombination to realize the inactivation of acetolactate decarboxylase activity.

[0026] The strain of CGMCC 1.6366 has been disclosed in the published literature (Wei Dong, Wang Min, Shi Jiping, Hao Jian. Red recombinase assisted gene replacement in Klebsiella pneumoniae. Journal of Industrial Microbiology & Biotechnology. 2012 39:1219-1226). This strain is a strain used to produce 1,3-propanediol, 2,3-butanediol, acetoin and 2-ketogluconic acid. The bacterium was isolated from soil, and the isolation process and characteristics are described in (Hao Jian, et al. Isolation and characterization of microorganisms able to produce 1,3-propanediol under aerobic conditions. World Journal of Microbiology Biotechnology 2008, 24:1731-1740).

[0027] 1) The acetolactate decarboxylase gene sequence of CGMCC 1.6366 strain was amplified ...

Embodiment 2

[0045] The acetolactate decarboxylase gene of Klebsiella pneumoniae SARI 01 and SARI 02 strains is inactivated by gene recombination to realize the inactivation of acetolactate decarboxylase activity. SARI 01 and SARI 02 are two strains of Klebsiella pneumoniae isolated from soil by the Shanghai Institute for Advanced Study, Chinese Academy of Sciences. The separation process was the same as described in (Hao Jian, et al. Isolation and characterization of microorganisms able to produce 1,3-propanediol under aerobic conditions. World Journal of Microbiology Biotechnology 2008, 24:1731-1740).

[0046] The pDK6-red plasmid was transformed into SARI 01, and the SARI 01 transformed with the pDK6-red plasmid was named SARI 01-pDK6-red strain. The linear DNA fragment B obtained in Example 1 was electroporated to transform SARI 01-pDK6-red competent cells. Streptomycin was used to screen the resistant strain, and the obtained resistant strain was named KpS1-ΔbudA. The acetolactate de...

Embodiment 3

[0049] A gene recombination method is used to construct Klebsiella pneumoniae in which the acetolactate decarboxylase gene and the lactate dehydrogenase gene are simultaneously inactivated, so as to realize the simultaneous inactivation of the acetolactate decarboxylase and lactate dehydrogenase activities.

[0050] 1) Amplify the Klebsiella pneumoniae lactate dehydrogenase gene sequence by PCR, connect it to a cloning vector by TA cloning method, and perform DNA sequence determination.

[0051] According to Klebsiella pneumoniae 342 genome information, design lactate dehydrogenase gene PCR primers, upstream primer ldhA-s: AGAGCGCACAGGACCACTATCCA (shown in SEQ ID NO.10), downstream primer ldhA-a: TCGGCGAGCTTATAGACCAGCGT (SEQ ID NO.11 shown).

[0052] Through the above primers, Klebsiella pneumoniae CGMCC 1.6366 genomic DNA was used as a template to amplify by PCR to obtain the lactate dehydrogenase gene and adjacent fragments, which were connected to pMD-18T simple plasmid (co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses modified klebsiella pneumoniae and applications of modified klebsiella pneumoniae in producing alpha-ketoisovaleric acid and isobutanol. The modified klebsiella pneumoniae is klebsiella pneumoniae with deactivated acetolactate decarboxylase and deactivated lactic dehydrogenase. The modified klebsiella pneumoniae is adopted for carrying out fermentation production of alpha-ketoisovaleric acid and isobutanol under the neutral pH and micro-oxygen condition. For the method provided by the invention, no exogenous genes are introduced in strain production, thus the genetic stability of the strain is high, the final concentration of the product is high, and the range of the raw materials is wide.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for producing α-ketoisovaleric acid and isobutanol by Klebsiella pneumoniae. Background technique [0002] α-Ketoisovaleric acid is a kind of α-keto acid. α-keto acid is unstable and easy to decarboxylate, resulting in very few α-keto acids naturally occurring in nature. In organisms, α-keto acids generally only exist in the form of intermediates, which are the precursors of various substances in organisms. α-Ketoisovalerate is an important cellular intermediate metabolite. α-Ketoisovaleric acid is a precursor for the synthesis of L-valine, L-leucine and pantothenic acid, and is now used as a substitute for L-valine, L-leucine in patients with chronic kidney disease. Using α-ketoisovaleric acid as raw material, using L-valine dehydrogenase and glucose dehydrogenase to catalyze the reaction, L-valine can be synthesized by reductive amination (Appl Mic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/20C12P7/40C12P7/04C12R1/22
Inventor郝健顾金杰周吉东魏东史吉平姜标
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI