Detection method for salmonella enteritidis and detection kit

A detection kit and Salmonella detection technology, which is applied in biochemical equipment and methods, microbial measurement/inspection, and resistance to vector-borne diseases, etc. It can solve the problems that the detection sensitivity needs to be further improved, it is difficult to promote on a large scale, and it is difficult to detect directly , to achieve the effect of rapid response, low cost and high sensitivity

Active Publication Date: 2017-06-20
GUANGDONG INST OF ECO ENVIRONMENT & SOIL SCI
View PDF8 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is often necessary to lyse the bacteria, which is difficult to detect directly, or involves the use of expensive instruments, which is difficult to promote on a large scale, and the detection sensitivity needs to be further improved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for salmonella enteritidis and detection kit
  • Detection method for salmonella enteritidis and detection kit
  • Detection method for salmonella enteritidis and detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] A detection method for salmonella, carried out according to the following steps:

[0074] (1) Use Tris-HCl buffer (10 mM, pH 7.9, containing 50 mM NaCl, 10 mM MgCl 2 and 100 μg / ml BSA) to dissolve nucleic acid H1 and H2 respectively. Mix 1 M H1 with Salmonella and react at room temperature for 30 minutes.

[0075] (2) Add 1 M H2, mix well, and react at room temperature for 30 minutes.

[0076] (3) Add 25 U of endonuclease Nt.BbvCI, mix thoroughly, and react at room temperature for 90 minutes.

[0077] (4) Add 0.3 M Hemin (hemin) and react at room temperature for 30 minutes. Take out 50 L of reaction solution and add it to 950 L of chromogenic buffer system (containing 26.6 mM citric acid, 51.4 mM disodium hydrogen phosphate, 25 mM KCl, 10 L of 0.5% TMB, 20 L of 30% H 2 o 2 , pH=5.0), react at room temperature for 15 minutes, and observe the color change. When Salmonella is present, the solution turns blue, and when there is no Salmonella, the solution is colorless....

Embodiment 2

[0079] A Salmonella detection kit includes the following components:

[0080] (1) Nucleic acids H1 and H2, the sequences of which are as follows:

[0081] Nucleic acid sequence H1: 3'-TGATGGCTGTAGTGTTTCCGGGTTATCACTAGTTTGGTGGCACCAATGTCAGTCTCCTC (A)-TTCGGAGTCGCTA (B)-GAGGAGAC (C)-5' (SEQ ID NO: 1);

[0082] Nucleic acid sequence H2: 5'-AGTACTAG (D)-GGGTAGGGCGGGTTGGG (F)-CC↓TCAGC (H)-GGGTAGGGCGGGTTGGG (G)-CTAGTACT (E)-3' (SEQ ID NO: 2); (the arrow indicates the cleavage site );

[0083] (2) Endonuclease Nt.BbvCI;

[0084] (3) Hybridization buffer containing 10 mM Tris-HCl, pH 7.9, containing 50 mM NaCl, 10 mM MgCl 2 and 100 μg / ml BSA;

[0085] (4) Hemin;

[0086] (5) Chromogenic buffer system, including 26.6 mM citric acid, 51.4 mM disodium hydrogen phosphate, 25 mM KCl, 10 L 0.5% TMB, 20 L 30% H 2 o 2 , pH=5.0.

Embodiment 3

[0088] Detection of different concentrations of Salmonella:

[0089] Prepare Salmonella standard solution, the concentration is 1x10 1 cfu / mL, 1x10 2 cfu / mL, 1x10 3 cfu / mL, 1x10 4 cfu / mL, 1x10 5 cfu / mL, 1x10 6 cfu / mL Store at 4°C. The Salmonella solution of different concentrations is added respectively in the reaction system described in embodiment 1, observes experimental result after fully reacting, as figure 2 As shown, 10 cfu / mL of Salmonella can produce a clear blue change, indicating that its detection limit is 10 cfu / mL. As the concentration of Salmonella increased, the color also increased and gradually became saturated.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection method for salmonella enteritidis and a detection kit. A salmonella enteritidis specific aptamer is taken as a molecular recognition element, a stem-loop structure nucleic acid H1 is opened under the action of salmonella enteritidis to undergo interaction with a stem-loop structure nucleic acid H2 so as to form partial double-stranded DNA, which includes endonuclease recognition sequences, H2 is incised under the action of endonuclease to release G basic group-rich nucleotide sequences. Under the action of Hemin, a G tetramer structure with similar HRP catalytic activity is formed, can achieve catalytic oxidation of chromogenic reaction to turn colourless substrate into blue. The method provided by the invention has high sensitivity, has a detection limit is 10 cfu / mL, also has good specificity, and other common bacteria have no influence on detection. The whole detection process can be completed at room temperature. The method has the advantages of simple operation, economical efficiency and cheapness, etc. The detection result can be directly observable, and no detecting instrument is sneeded. The method can detect living bacteria directly, and has no need for lysis of bacteria.

Description

technical field [0001] The invention belongs to the field of rapid detection of microorganisms, and in particular relates to a detection method and a detection kit for Salmonella. Background technique [0002] salmonella( Salmonella enteritidis ) is an important pathogenic genus in Enterobacteriaceae. It can cause sepsis, gastroenteritis, and even abortion in humans and animals, and can cause food poisoning in humans. It is one of the most important pathogenic bacteria in human bacterial food poisoning and seriously endangers food safety. and human health. [0003] Traditional Salmonella detection techniques mainly include phage lysis experiments, PCR technology, antibody detection, etc. However, it is often necessary to lyse the bacteria, which is difficult to detect directly, or involves the use of expensive instruments, which is difficult to promote on a large scale, and the detection sensitivity needs to be further improved. [0004] Therefore, there is an urgent need...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10
CPCC12Q1/6816C12Q2521/301C12Q2527/125Y02A50/30
Inventor陈俊华王荣萍温俊林陈曼佳
OwnerGUANGDONG INST OF ECO ENVIRONMENT & SOIL SCI