Preparation method of varicella-zoster virus glycoprotein E extracellular domain protein

A herpes zoster virus and extracellular region technology, which is applied in the field of preparation of varicella-zoster virus glycoprotein E extracellular region protein, can solve the problem that protein immunogenicity is not closely related to glycosylation, and protein glycosylation is not closely related. Inconsistency, protein heterogeneity and other problems, to achieve the effect of good immunogenicity, good immunogenicity and simple method

Inactive Publication Date: 2017-08-08
CHANGCHUN KEYGEN BIOLOGICAL PROD
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are also researchers who only intercept the 37-161 amino acid conserved sequence of gE to develop a subunit vaccine, but it is not conducive to the application because of its small fragment, less covered epitopes, and weak immunogenicity.
[0007] Eukaryotic cell expression system expresses low protein expression and inconsistent protein glycosylation, resulting in heterogeneity of proteins, and the immunogenicity of some proteins is not closely related to glycosylation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of varicella-zoster virus glycoprotein E extracellular domain protein
  • Preparation method of varicella-zoster virus glycoprotein E extracellular domain protein
  • Preparation method of varicella-zoster virus glycoprotein E extracellular domain protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Preparation of varicella-zoster virus glycoprotein E protein antigen

[0043] 1. Target gene amplification

[0044] (1) Primer design

[0045] According to the varicella-zoster virus glycoprotein E gene sequence published on Genbank, select the nucleic acid sequence corresponding to the amino acid sequence 25-537 to design primers with Nhe I and EcoR I restriction sites (marked in italics) at both ends:

[0046] The forward primer is (5'-3'): TCCTA GCTAGC AT GACCAATCCGGTTCGCGCCAGCGTGC;

[0047] The reverse primer is (5'-3'): TTCCG GAATTC TTAATGATGATGATGATGATGACGCAGC

[0048] AGCGGGCTTGTACCCGGAT;

[0049] (2) PCR amplification

[0050] Using the synthesized plasmid as a template, use the above primers for nucleic acid amplification. The specific reaction system is PrimeSTAR HSDNA polymerase buffer (5×) 10ul, dNTPs 4ul, Primer-F 1ul, Primer-R 1ul, template 1ul, PrimeSTAR HS DNA polymerase 0.5 ul, add deionized water to a total volume of 50ul; put the reaction tube...

Embodiment 2

[0073] Preparation of Protein Antigen of Varicella-Zoster Virus Glycoprotein E Extracellular Domain

[0074] (1) Primer design

[0075] According to the varicella-zoster virus glycoprotein E gene sequence published on Genbank, select the nucleic acid sequence corresponding to the amino acid sequence 25-539 to design primers with Nhe I and EcoR I restriction sites (marked in italics) at both ends:

[0076] The forward primer is (5'-3'): TCCTA GCTAGC ATGACCAATCCGGTTCGCGCCAGCGTGC; reverse primer is (5'-3'): TTCCG GAATTC TTAATGATGATGATGATGATGCGCATAACGCAGCAGCGGGCTTGTAC;

[0077] (2) Ligation of PCR product and cloning vector

[0078] Amplify the target fragment according to the designed primers, after recovery, carry out enzyme digestion with the carrier, quantify the target gene and carrier enzyme digestion products, take 12ul and 2ul respectively, add 10× T4 ligase buffer 2ul, T4 ligase 1ul , add deionized water to 20ul, and connect overnight at 16°C to obtain the recombinan...

Embodiment 3

[0085] Preparation of Protein Antigen of Varicella-Zoster Virus Glycoprotein E Extracellular Domain

[0086] 1. Primer design

[0087] According to the varicella-zoster virus glycoprotein E gene sequence published on Genbank, select the nucleic acid sequence corresponding to the amino acid sequence 25-546, and design primers with Nhe I and EcoR I restriction sites (marked in italics) at both ends,

[0088] The forward primer is (5'-3'): TCCTA GCTAGC ATGACCAATCCGGTTCGCGCCAGCGTGC;

[0089] The reverse primer is (5'-3'): TTCCG GAATTC TTAATGATGATGATGATGATGGCCCAGG

[0090] CCCGCGGTCCACGCCGCA;

[0091] 2. Ligation of PCR product and cloning vector

[0092] Amplify the target fragment according to the designed primers, after recovery, carry out enzyme digestion with the carrier, quantify the recovered products of the target gene and carrier enzyme digestion, take 12ul and 2ul respectively, add 10× T4 ligase buffer 2ul, T4 ligase 1ul, Add deionized water to 20ul, and connect ov...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of varicella-zoster virus glycoprotein E extracellular domain protein, and relates to a recombinant vector of the varicella-zoster virus glycoprotein E extracellular domain protein, a transformant prepared by use of the recombinant vector, a protein formed by use of the transformant and application of the protein in the fields of research and development of varicella vaccines, zoster virus vaccines, combined vaccines and other related vaccines containing the protein, and detection of corresponding antigens and antibodies, and the like. A VZV-gE extracellular nucleic acid sequence is cloned and connected with prokaryotic expression vector pET-21b to obtain the recombinant vector by genetic engineering technology, the recombinant vector is transformed into Escherichia coli BL21 (DE3) to obtain the transformant, and the target protein is obtained by inducible expression of the transformant. The expression system can be used for efficient VZV-gE extracellular antigen protein expression, and the expressed VZV-gE extracellular antigen protein has good immunogenicity, and can be used in the fields of research and development of the related vaccines and detection of the corresponding antigens and antibodies.

Description

[0001] Technical field: [0002] The invention provides a method for preparing the varicella-zoster virus glycoprotein E extracellular region protein, in particular to a recombinant plasmid vector containing the varicella-zoster virus glycoprotein E extracellular region gene, and the transformed varicella-zoster virus glycoprotein E extracellular region protein by using the transformant, involving the development, production, inspection and detection of the protein in monovalent, multivalent varicella or herpes zoster vaccines, and combined vaccines containing this component The application in the field belongs to the technical field of bioengineering. [0003] Background technique: [0004] Varicella-zoster virus (VZV) is the pathogen that causes chickenpox and herpes zoster. It first causes chickenpox in children, and can reactivate to cause herpes zoster after latent. Currently, the main method of controlling chickenpox and shingles is vaccination. [0005] Both the varice...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N1/21C07K14/04A61K39/295A61K39/25A61P31/22C12R1/19
CPCA61K39/00C07K14/005C12N15/70C12N2710/16722C12N2800/22
Inventor李春明徐俊峰双慧李海燕朱晓文王丽沈红杰
OwnerCHANGCHUN KEYGEN BIOLOGICAL PROD