Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting swine mycoplasmal pneumonia based on direct PCR (Polymerase Chain Reaction) and application of kit

A technology of mycoplasma swine pneumonia and a kit, which is applied in the biological field, can solve the problems of inaccurate results, poor sensitivity, time-consuming and labor-intensive problems, and achieve the effects of strong specificity, improved detection, and improved work efficiency

Pending Publication Date: 2017-08-18
INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it takes at least 3-4 days from bacterial isolation and culture to purification and DNA extraction to make a preliminary identification, which is not only time-consuming and laborious, but also inaccurate, and has poor sensitivity, which is prone to false positive results, which is not conducive to farmers and large-scale enterprises. Take appropriate serotype vaccines and drugs for timely treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting swine mycoplasmal pneumonia based on direct PCR (Polymerase Chain Reaction) and application of kit
  • Kit for detecting swine mycoplasmal pneumonia based on direct PCR (Polymerase Chain Reaction) and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] The direct PCR detection kit of the swine mycoplasma pneumonia pathogen of the present embodiment, composition comprises:

[0019] (1) Lysis solution: 2-4M isothiocyanate, 7-10M ethylenediaminetetraacetic acid, 15-20M lauryl sarcosine, 3-6% (volume ratio) polyvinylpyrrolidone.

[0020] (2) PCR amplification reagent: 5×PCR Buffer, 2.0M dNTP, 10pM forward primer, 10pM reverse primer, high-fidelity Taq enzyme (5U / μl), 20mM MgCl 2 ,pure water.

[0021] The specific composition of each ingredient:

[0022] The reaction system is 25 μl, the lysed sample is 5 μl, MPSF (5′-GAAGCTATCAAAAAAGGGGAAACTA-3′) (10 pmol / μl) 2 μl, MPSR (3’-TGTATCGGTTTCAGAAGAAG-5′) (10 pmol / μl) 2 μl, 5×PCR Buffer 5 μl , 2.0mM / L dNTPs 5μl, high-fidelity Taq enzyme 0.5μl (5U / μl), 20mM MgCl 2 3.5μl, 2μl purified water, mix thoroughly and centrifuge briefly.

[0023] One pair of specific primers is as follows: MPSF: GAAGCTATCAAAAAAGGGGAAACTA, MPSR: TGTATCGGTTTCAGAAGAAG.

[0024] The kit is used to direc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit and application of the kit, in particular to a kit for detecting swine mycoplasmal pneumonia based on direct PCR (Polymerase Chain Reaction) and application of the kit, and belongs to the technical field of biologics. The kit provided by the invention comprises the following reagents: lysate, a PCR amplification reagent, a positive control and a negative control. By adopting the kit, the swine mycoplasmal pneumonia can be rapidly and accurately detected. When the kit is used, single samples infected with swine mycoplasma pneumonia can be detected, hybrid infection of clinical cases can also be detected, and the kit also can be applied to general investigation, molecular epidemiological investigation and vaccine screening and monitoring for swine mycoplasma pneumonia pathogeny.

Description

technical field [0001] The invention relates to a kit and application thereof, in particular to a kit for direct PCR detection of swine mycoplasma pneumonia pathogen and application thereof, belonging to the field of biotechnology. Background technique [0002] Mycoplasma pneumonia of swine (MPS), also known as swine enzootic pneumonia, commonly known as swine asthma, is a chronic respiratory infectious disease of pigs caused by Mycoplasma hyopneumoniae. The main clinical symptoms are cough and wheezing, and the pathological changes are characterized by the apical lobe, heart lobe, middle lobe, and septal lobe showing meaty or shrimp-meat-sheep consolidation. The disease is widely distributed all over the world and is characterized by high contact, high infectivity, high morbidity and low mortality. The main clinical manifestations are cough, wheezing, dyspnea, decreased daily weight gain, long-term poor growth, and a sharp drop in feed remuneration. The disease often coop...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/689C12Q2565/125C12Q2545/113
Inventor 李海利徐引弟王治方张青娴朱文豪方剑玉侯自花
Owner INST OF ANIMAL HUSBANDRY & VETERINARY MEDICINE HENAN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com