Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of novel guide RNA (Ribonucleic Acid) expression cassette in CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system

An expression cassette and RNA polymerase technology, applied in DNA/RNA fragments, stably introducing foreign DNA into chromosomes, recombinant DNA technology, etc., can solve problems such as interference binding, cumbersome construction of guide RNA expression system, and low transcriptional activity

Active Publication Date: 2017-09-15
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This may be due to the post-transcriptional modification of the guide RNA caused by the type II promoter, such as read-through or 5'-capping and 3'-tailing, which interferes with the binding of the guide RNA to Cas9, or due to the relatively low transcriptional activity.
When using PgpdA for guide RNA transcription in Aspergillus, the researchers added hammerhead ribozyme HH (hammerhead, HH) and hepatitis delta virus ribozyme HDV (hepatitis delta virus, HDV) to reduce interference, but because there are six bases in the hammerhead ribozyme HH that need to be complementary to the target sequence in the guide RNA, the construction of the guide RNA expression system is relatively cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of novel guide RNA (Ribonucleic Acid) expression cassette in CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system
  • Application of novel guide RNA (Ribonucleic Acid) expression cassette in CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system
  • Application of novel guide RNA (Ribonucleic Acid) expression cassette in CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0113] Example 1. Establishment of a novel CRISPR / Cas9 system using 5S rRNA as a promoter to initiate guide RNA expression

[0114] In this example, the 5S rRNA of Aspergillus niger was used as the promoter to construct the expression cassette of the guide RNA. In the test, the polyketide synthase albA was used as the target gene. albA is involved in the synthesis of Aspergillus niger spore pigment. The inactivation of albA gene will lead to albino spores, and the colonies will appear white, while the strains without albA gene inactivation will appear black colonies. The ratio of albino colonies to all colonies can be used to represent the efficiency of the genome editing system.

[0115] 1.1 Selection of target sequence

[0116] The present invention selects the following four sites of the albA gene as target sequences for the detection of genome editing efficiency of the novel CRISPR / Cas9 system. The specific sequence is as follows:

[0117] Guide RNA-albA-188: AGTGGGATCT...

Embodiment 2

[0167] Example 2. Establishment of a novel CRISPR / Cas9 system utilizing 5S rRNA-ribozyme-guide RNA expression cassette

[0168] In order to test the effect of HDV ribozyme, 5S rRNA was designed as a promoter, and HDV was added as ribozyme in the middle to complete the self-processing of guide RNA transcription, so as to construct the expression cassette of guide RNA 5S rRNA-HDV-sgRNA, such as figure 2 shown. In order to test the effect of HH ribozyme, 5S rRNA was designed as the promoter, and HH was added as ribozyme in the middle to complete the self-processing of guide RNA transcription, so as to construct the guide RNA expression cassette 5S rRNA-HH-sgRNA, such as figure 2 shown. The construction of 5S rRNA-HDV-sgRNA and 5SrRNA-HH-sgRNA expression cassettes was completed by fusion PCR. The primer sequence design is shown in Table 1. The specific construction and transformation process of Aspergillus niger are as described above, and will not be repeated here.

[0169]...

example 1

[0176] Comparative example 1. Using the U6 promoter to start the guide RNA to express the CRISPR / Cas9 system

[0177] In order to compare the efficiency of the traditional U6 promoter, the inventors simultaneously designed a series of U6 promoters from different sources to mediate the transcription of the guide RNA, and carried out the hU6 sequence derived from humans in the Aspergillus niger genome and the NCBI database. BLAST. Then select the promoters of hU6 from human, yU6 from yeast, and anU6 from Aspergillus niger to start the in vivo transcription of guide RNA, so as to construct the expression cassettes of guide RNA PhU6-sgRNA, PyU6-sgRNA and PanU6- sgRNA, such as figure 2 shown.

[0178] PhU6-sgRNA sequence is as follows (SEQ ID NO:23):

[0179] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel guide RNA (Ribonucleic Acid) expression cassette used in a CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system. According to the guide RNA expression cassette, a 5S rRNA gene is adopted as a starter to start expression of guide RNA. The invention further provides a CRISPR / Cas system with the guide RNA expression cassette and a method for editing genomes by using the system. The guide RNA expression cassette, the CRISPR / Cas system and the genome edition method provided by the invention have the advantages of universality, high efficiency, convenience, accuracy and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology; specifically, the invention relates to a novel guide RNA expression cassette with a 5S rRNA gene as a promoter and its application in a CRISPR / Cas system. Background technique [0002] The CRISPR / Cas (clustered regularly interspaced short palindromic repeats / CRISPR-associated proteins) system is an acquired immune system in bacteria and archaea against foreign virus or plasmid DNA invasion. The nuclease of this system recognizes and degrades foreign DNA under the guidance of crRNA. Among them, the type II CRISPR / Cas system has a simple composition, including only one nuclease Cas9 and tracrRNA:crRNA dimer to complete the recognition and cutting functions. The CRISPR / Cas9 system has rapidly become a new generation of genome editing technology due to its advantages of simple design and operation, high editing efficiency and wide versatility, and has been widely used in humans, mice, rats, zebrafish, C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/90
CPCC12N15/113C12N15/902C12N2310/10
Inventor 孙际宾郑小梅郑平马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com