Application of novel guide RNA (Ribonucleic Acid) expression cassette in CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) system
An expression cassette and RNA polymerase technology, applied in DNA/RNA fragments, stably introducing foreign DNA into chromosomes, recombinant DNA technology, etc., can solve problems such as interference binding, cumbersome construction of guide RNA expression system, and low transcriptional activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0113] Example 1. Establishment of a novel CRISPR / Cas9 system using 5S rRNA as a promoter to initiate guide RNA expression
[0114] In this example, the 5S rRNA of Aspergillus niger was used as the promoter to construct the expression cassette of the guide RNA. In the test, the polyketide synthase albA was used as the target gene. albA is involved in the synthesis of Aspergillus niger spore pigment. The inactivation of albA gene will lead to albino spores, and the colonies will appear white, while the strains without albA gene inactivation will appear black colonies. The ratio of albino colonies to all colonies can be used to represent the efficiency of the genome editing system.
[0115] 1.1 Selection of target sequence
[0116] The present invention selects the following four sites of the albA gene as target sequences for the detection of genome editing efficiency of the novel CRISPR / Cas9 system. The specific sequence is as follows:
[0117] Guide RNA-albA-188: AGTGGGATCT...
Embodiment 2
[0167] Example 2. Establishment of a novel CRISPR / Cas9 system utilizing 5S rRNA-ribozyme-guide RNA expression cassette
[0168] In order to test the effect of HDV ribozyme, 5S rRNA was designed as a promoter, and HDV was added as ribozyme in the middle to complete the self-processing of guide RNA transcription, so as to construct the expression cassette of guide RNA 5S rRNA-HDV-sgRNA, such as figure 2 shown. In order to test the effect of HH ribozyme, 5S rRNA was designed as the promoter, and HH was added as ribozyme in the middle to complete the self-processing of guide RNA transcription, so as to construct the guide RNA expression cassette 5S rRNA-HH-sgRNA, such as figure 2 shown. The construction of 5S rRNA-HDV-sgRNA and 5SrRNA-HH-sgRNA expression cassettes was completed by fusion PCR. The primer sequence design is shown in Table 1. The specific construction and transformation process of Aspergillus niger are as described above, and will not be repeated here.
[0169]...
example 1
[0176] Comparative example 1. Using the U6 promoter to start the guide RNA to express the CRISPR / Cas9 system
[0177] In order to compare the efficiency of the traditional U6 promoter, the inventors simultaneously designed a series of U6 promoters from different sources to mediate the transcription of the guide RNA, and carried out the hU6 sequence derived from humans in the Aspergillus niger genome and the NCBI database. BLAST. Then select the promoters of hU6 from human, yU6 from yeast, and anU6 from Aspergillus niger to start the in vivo transcription of guide RNA, so as to construct the expression cassettes of guide RNA PhU6-sgRNA, PyU6-sgRNA and PanU6- sgRNA, such as figure 2 shown.
[0178] PhU6-sgRNA sequence is as follows (SEQ ID NO:23):
[0179] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTA...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com