A promoter hlp3 induced by light or auxin
A promoter and auxin technology, applied in the field of plant bioengineering breeding and molecular biology, can solve the problems of unseen promoter cloning and application, and achieve the effect of enhancing the expression level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Acquisition of Arabidopsis HLP3 Promoter
[0028] In order to obtain inducible promoters, the inventors cloned the promoters of more than 100 genes from the Arabidopsis genome, and conducted large-scale screening for the activities of these promoters one by one. It was found that the HLP3 promoter has strong activity induced by light or auxin. The specific cloning process is described below.
[0029] 1) First, according to the Arabidopsis TAIR database, the regulatory sequence about 1.6 kb upstream of the translation initiation codon ATG of the HLP3 gene was selected as the HLP3 promoter sequence.
[0030] 2) According to the above sequence, use PRIMER5.0 software to design PCR amplification primers as follows.
[0031] HLP3-F: 5' AAGCTT AGGATTAGTTTTGCTATCGGTTA 3';
[0032] HLP3-R:5' GGATCC TTTCTTCTTCTTATCTTTTTCTTTTC3'.
[0033] A HindIII restriction site was added to the 5' end of the upstream primer, and a BamHI restriction site was added to the 5' e...
Embodiment 2
[0038] Example 2 Construction of Plant Expression Vector of Arabidopsis HLP3 Promoter and Agrobacterium Transformation
[0039] The purpose is to obtain the vector expressing the glucuronidase reporter gene (GUS) driven by the HLP3 promoter, and obtain the Agrobacterium containing the vector at the same time, so as to prepare for the subsequent transformation of Arabidopsis thaliana.
[0040] 1) The HLP3 promoter was cut out from the pMD-T18 intermediate vector with two restriction enzymes, HindIII and BamHI, and the pBI121 plant expression vector was also cut with the same two enzymes (the endonuclease was purchased from Takara Company, specifically For the conditions and procedures of enzyme digestion, please refer to its instructions). The digested product was recovered by agarose gel electrophoresis using a gel recovery kit from Tiangen Company (refer to the instruction manual).
[0041] 2) Ligate the obtained promoter fragment after digestion with the vector (use T4 DNA ...
Embodiment 3
[0044] Example 3 Transformation of Arabidopsis with HLP3 promoter to verify that it is strongly induced by light or auxin
[0045] The purpose is to transfer the HLP3 promoter-GUS expression vector into Arabidopsis thaliana to obtain transgenic plants for verifying whether the HLP3 promoter can be induced by light or auxin.
[0046] 1) Infect flower buds of Arabidopsis thaliana with Agrobacterium GV3101 containing a plant expression vector using the flower-dipping method (an open general method). After the siliques that grow out are mature, collect the T1 generation seeds and screen on the selection medium (MS medium with 30mg / L kanamycin added), and transplant the green transformed seedlings that can grow normally into the nutrient soil Cultivate, harvest the T2 generation seeds respectively, and then carry out the next round of kanamycin screening, and select the green seedlings:white seedlings in a 3:1 petri dish. The green seedlings on the petri dish were transplanted, an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More