Modified nitrile hydratase and application thereof

A nitrile hydratase and amino acid technology, applied in the application, enzyme, lyase and other directions, can solve the problems of fluctuation of hydration temperature, insufficient supply of cold energy for temperature control, poor heat resistance of enzyme-producing cells, etc., to improve product tolerance , the effect of improving heat resistance and good industrial application prospects

Active Publication Date: 2017-09-19
TSINGHUA UNIV
View PDF10 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In addition to product / substrate tolerance, in the catalytic hydration process of microbial production of acrylamide, another major problem that restricts production efficiency is the poor heat resistance of enzyme-producing cells, and the hydration temperature must be controlled by low-temperature refrigerants. 15-22℃
Since nitrile hydratase catalyzes the hydration of acrylonitrile to form acrylamide is a strong exothermic reaction, the supply of cooling capacity for temperature control in industrial production is often insufficient, resulting in fluctuations in the hydration temperature above 25 °C

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified nitrile hydratase and application thereof
  • Modified nitrile hydratase and application thereof
  • Modified nitrile hydratase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1: Nitrile hydratase SBMDB gene replacement process after transformation

[0033] (1) Using the plasmid pNV-SBM (Chen Jie et al., Catalytic Kinetics of Recombinant Nitrile Hydratase Coupled with Terminal Salt Bridge and Site-directed Mutation. Acta Chemical and Chemical Industry, 2014, 65(7): 2821-2828) as template, reverse polymerization Enzyme chain reaction (PCR) method for gene mutation. The substitution Aspβ215Cys was first introduced to the β subunit of the nitrile hydratase SBM.

[0034] Forward primer SBM-beta215-sense: TGTGTAGTGTGCGTCGATCTCTG; reverse primer SBM-beta215-anti: TTTCCCGTTTCCGTCGTCG.

[0035] The PCR reaction system is:

[0036]

[0037]

[0038] The reaction conditions are:

[0039]

[0040] The obtained PCR amplification products were recovered using the E.Z.N.A.Gel Extraction Kit produced by OMEGA Biotek, and the recovery process was completed according to the process described in the instructions. The obtained DNA fragme...

Embodiment 2

[0047] Example 2: Construction of transformed nitrile hydratase transformants and expression of transformed nitrile hydratase in transformants

[0048] The plasmid PNV-SBMDB of the modified nitrile hydratase gene (shown in SEQ ID NO: 3) obtained in Example 1 was transferred into the host bacterium Rhodococcus ruber R. ruber TH3 by electroporation. The transformant was screened with a rhodococcus plate medium containing 25 mg / L of kanamycin to obtain the transformant R.ruber TH3 / pNV-SBMDB.

[0049] The obtained expression strain R.ruberTH3 / pNV-SBMDB was cultured by shake flask fermentation. First inoculate in Rhodococcus seed culture medium containing 25mg / L kanamycin, and culture at 28°C and 200rpm for 36h.

[0050] Inoculate 10% of the cultured seed liquid into the Rhodococcus fermentation medium, and cultivate at 28° C. and 200 rpm for 48 hours. The resulting cells were assayed for enzyme activity.

[0051] The composition of Rhodococcus plate medium is: glucose 10g / L, ye...

Embodiment 3

[0056] Embodiment 3: the stress resistance assessment of nitrile hydratase after transformation

[0057] The 50mL expression bacterial strain R.ruber TH3 / pNV-SBMDB cell (expression transforming nitrile hydratase) and the control bacterial strain R.ruber TH3 / pNV-SBM cell of harvest in embodiment 2 are washed once with deionized water of equal volume, again Suspend in an equal volume of 10 mM PBS buffer.

[0058] Take 5 mL of the resuspended cells and place them in a water bath at 60°C for 10 min. The residual enzyme activity of modified nitrile hydratase and unmodified nitrile hydratase was measured, and the results showed that the residual enzyme activity of modified nitrile hydratase was 69.40%, while that of unmodified nitrile hydratase was only 29.47%. The thermostability of the modified nitrile hydratase was significantly improved (such as figure 2 ).

[0059] 20 mL of resuspended recombinant cells were placed in 100 mL Erlenmeyer flasks, and acrylamide was added dropw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses modified nitrile hydratase and application thereof in the technical field of enzyme engineering and industrial microorganisms. A method for obtaining the modified nitrile hydratase disclosed by the invention is that Pro of 133 site of a alpha subunit of an amino acid sequence shown as by a sequence table SEQ ID NO:2 and Asp of 215 site of a beta subunit of an amino acid sequence shown as by a sequence table SEQ ID NO:1 are respectively replaced with Cys, so that a disulfide bond is formed between the two subunits. Stress resistance and heat resistance of the modified nitrile hydratase disclosed by the invention and product tolerance are all obviously improved, and activity of the nitrile hydratase is not lowered. The modified nitrile hydratase can be catalyzed to obtain a high-concentration acrylamide product, and can be recycled repeatedly.

Description

technical field [0001] The invention belongs to the technical fields of enzyme engineering and industrial microbes, and in particular relates to a modified nitrile hydratase and its application. Background technique [0002] Nitrile hydratase produced by microorganisms can efficiently catalyze the hydration of acrylonitrile to acrylamide. Polyacrylamide produced by the polymerization of acrylamide has a very wide range of applications in industrial production fields such as tertiary oil recovery, water treatment, and papermaking. The use of nitrile hydratase produced by microorganisms to catalyze the production of acrylamide has a series of advantages, including the reaction at normal temperature and pressure, low energy consumption, simple and safe operation, high conversion rate of acrylonitrile, high product concentration and purity, etc. Primary method of amide production. [0003] The focus of research on microbial production of acrylamide is the discovery and transfo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N15/74C12N15/77C12N1/21C12P13/02
CPCC12N9/88C12P13/02C12Y402/01084
Inventor于慧敏焦松张婧沈忠耀
OwnerTSINGHUA UNIV