IL-17 antibody

A technology for IL-17 and antibodies, applied in the direction of antibodies, anti-inflammatory agents, anti-tumor drugs, etc. Refrigeration and other issues

Active Publication Date: 2017-10-10
STAIDSON BEIJING BIOPHARMACEUTICALS CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the pharmacokinetic properties and efficacy of the existing anti-IL-17 in vivo are not very satisfactory, and the transp

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • IL-17 antibody
  • IL-17 antibody
  • IL-17 antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0101] Example 1: Antibody Preparation

[0102] 1. Carrier Construction

[0103] First synthesize the coding genes of the heavy chain H3-1 of the antibody and the light chain sequence L3, after PCR amplification, the DNA sequence and the pcdna3.1 vector (Invitrogen, V79020) was subjected to double enzyme digestion, and the digested vector and target DNA fragments were recovered separately, and then ligated using a DNA ligase kit (Takara / 6022) at 16°C for 1 hour to ligate the heavy chain and the digested product of the vector, the light chain and the vector, respectively. The product was digested, so that the heavy chain and light chain of the antibody were respectively constructed on the pcdna3.1 vector to form the heavy chain pcdna3.1 (H3-1) and light chain plasmid pcdna3.1 (L3).

[0104] The above-mentioned heavy chain H3-1 coding gene includes a signal peptide sequence (ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCCACCGGTGTACACTCA, SEQ ID NO: 35), a heavy chain variable region...

Embodiment 2

[0123] Example 2 KD Detection of Binding Affinity Between IL-17 Antibody and Antigen

[0124] 1. Instrument and principle

[0125] In this experiment, biofilm layer interferometry (BLI) was used to detect and evaluate the affinity between IL-17 antibody and antigen, so as to determine the superiority of the selected antibody in terms of kinetics and affinity. The experiment was carried out using an Octet instrument (Fortebio company, model QKe). Biotinylation kit (EZ-Link TM Sulfo-NHS-Biotin cat:21326) for biotin labeling.

[0126] 2. Experimental method

[0127] The experiment mainly includes the following steps (the experiment is carried out at room temperature unless otherwise specified): turn on the power of the machine Octet, and preheat the machine for more than 1 hour. Place the unused SA sensor on the removal rack, add 300ul DPBS buffer (0.05% BSA, 0.1% Tween) to the corresponding well below the removal rack, and incubate the sensor in the buffer for more than 10mi...

Embodiment 3

[0146] Example 3 Determination of hIL-17 Antibody Inhibitory Activity

[0147] 1. Principles and materials

[0148] The hIL-17 antibody was used to act on hIL-17A-stimulated human embryonic skin fibroblasts (referred to as CCC-ESF-1 cells, Concorde Cell Resource Center), and the IL- 6 level, indicating the inhibitory activity of hIL-17 antibody, in which IL-6 was quantified with human IL-6 Elisa detection kit (R&D system, D6050).

[0149] 2. Experimental method

[0150] CCC-ESF-1 cells at 1×10 4 Cells / well were seeded in 96-well cell culture plates at 37°C, 5% CO 2 Incubate overnight. Then divide into blank control group, control group and experimental group to treat the cells.

[0151] (1) The blank control group was diluted by adding DMEM cell culture medium (Gibco, 11995-065);

[0152] (2) Add 30ng / ml (1.67pmol / ml) hIL-17A (Genscript, Z03228-50) to the control group;

[0153] (3) Experimental group: when the dose of added hIL-17 antigen is constant (final concentrati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an IL-17 antibody, and belongs to the field of biomedicine. The IL-17 antibody comprises a heavy chain and a light chain, wherein the heavy chain and the light chain respectively comprise variable regions and constant regions; the sequence of the heavy chain variable regions comprises hypervariable regions HCDR1, HCDR2 and HCDR3 in turn; and the sequence of the light chain variable regions comprises hypervariable regions LCDR1, LCDR2 and LCDR3 in turn. The invention has the following advantage: The IL-17 antibody is an antibody which is high in thermal stability and simultaneously has high affinity, high inhibition activity and a curative effect.

Description

technical field [0001] The invention relates to an IL-17 antibody and belongs to the field of biomedicine. Background technique [0002] So far, six family members of the interleukin 17 (IL-17) family of cytokines have been discovered: IL-17A (IL-17), IL-17B, IL-17C, IL-17D, IL-17E ( Also named IL-25) and IL-17F. IL-17 is the prototype of the IL-17 family. IL-17 family members function in the form of homodimers or heterodimers. All IL-17 family members have four highly conserved cysteine ​​residues A group that participates in the formation of intrachain disulfide bonds and has two or more cysteine ​​residues that participate in the formation of interchain disulfide bonds. Many functions of IL-17 family members have been reported, which are mainly involved in the regulation of immune responses. [0003] Interleukin 17 (IL-17, also known as IL-17A) is a 20-30 kD homodimeric glycoprotein that is activated CD4 + T cell subset T H A characteristic cytokine secreted by 17 ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K16/24C12N15/13C12N15/85C12N5/10A61K39/395A61P19/08A61P19/02A61P29/00A61P19/10A61P17/06A61P1/00A61P11/00A61P37/06A61P11/06A61P35/00
CPCA61K2039/505C07K16/244C07K2317/565C12N15/85
Inventor 陈志张林王子铭
Owner STAIDSON BEIJING BIOPHARMACEUTICALS CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap