Preparation of cell growing slide assembly of CBA (cytometric bead array) kit for detecting MOG-IgG, CBA detection kit and application of CBA detection kit

A kit, the technology of MOG-293T, is applied in the direction of cells, applications, and animal cells modified by the introduction of foreign genetic material. It can solve the problems of production and sales of untested products, and achieve easy storage, convenient comparison, and improved accuracy. Effect

Inactive Publication Date: 2017-10-27
GENERAL HOSPITAL OF PLA
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Disadvantages of existing technologies: Existing studies have found that MOG has different epitopes, including linear peptide epitopes, conformational epitopes, and glycosylated epitopes
However, no matter at home or abroad, almost all attempts are limited to exploration for the purpose of basic scientific research, and no further clinical verification experiments have been carried out.
And there is no production and sales of related testing products in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation of cell growing slide assembly of CBA (cytometric bead array) kit for detecting MOG-IgG, CBA detection kit and application of CBA detection kit
  • Preparation of cell growing slide assembly of CBA (cytometric bead array) kit for detecting MOG-IgG, CBA detection kit and application of CBA detection kit
  • Preparation of cell growing slide assembly of CBA (cytometric bead array) kit for detecting MOG-IgG, CBA detection kit and application of CBA detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] A kind of preparation method of the CBA detection kit that is used for clinical sample MOG autoimmune IgG antibody detection, described preparation method comprises the following steps:

[0045] S1: MOG plasmid construction

[0046] (1) Using human oligodendrocytes as materials, extracting total mRNA;

[0047] (2) Using a reverse transcription kit to reverse transcribe the mRNA into cDNA;

[0048] (3) Design MOG-specific PCR primers to expand the full-length MOG cDNA; the forward primer sequence of the MOG-specific PCR primers is: ATGGCAAGCTTATC AAGACCC, and the reverse primer sequence is: GAAGGGATTTCGTAGCTCTTC;

[0049] (4) Cloning the amplified MOG cDNA and connecting it to the pLVX-IRES-mcherry lentiviral plasmid vector;

[0050] (5) Then transform the pLVX-IRES-mcherry lentiviral plasmid, shake the bacteria, and perform amplification and extraction to obtain the MOG plasmid;

[0051] S2: Lentiviral packaging that overexpresses the MOG gene, see Figure 7 An over...

Embodiment 2

[0070] A CBA detection kit for the detection of MOG autoimmune IgG antibody in clinical samples, the kit includes anti-human IgG-FITC secondary antibody, blocking solution, 10×PBS, anti-fluorescent bleaching mountant and MOG-IgG CBA detection Use the cell slide assembly; the blocking solution is preferably 10% goat serum.

[0071] Preferably, the cell slide assembly for MOG-IgG CBA detection is prepared from slides or slides containing small chambers, Vector-293T cells and MOG-293T cells, specifically, the slide containing small chambers contains 12 The detachable glass slides of chambers, wherein chamber 6 contains MOG-293T cells, and chamber 6 contains Vector-293T cells. For the specific preparation method, refer to step S4 of Example 1.

Embodiment 3

[0073] An application method of a CBA test kit, that is, the detection method using the test kit comprises the following steps:

[0074] Step1: The cell slide assembly for MOG-IgG CBA detection prepared in Example 1 or the cell slide assembly for MOG-IgG CBA detection described in Example 2 (abbreviated as cell slide assembly) can be stored at -80°C More than 12 months, store at -20°C for more than 1 month.

[0075] Step2: Take a clinical serum or cerebrospinal fluid sample. If it cannot be used immediately, it should be separated immediately and stored at -80°C to ensure the natural activity of the protein in the sample to the greatest extent;

[0076]Step3: According to the number of samples to be tested, determine the number of cell slide assemblies required. If no multiple wells are used, one cell slide assembly can detect 6 samples; if multiple wells are used, one cell slide assembly can detect 3 samples. .

[0077] Step4: Equilibrate the cryopreserved cell slide assemb...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the preparation of a cell slide assembly for a CBA kit for detecting MOG-IgG, the CBA detection kit and its application. The preparation method of the cell slide assembly is as follows: S1: construction of MOG plasmid; S2: overexpression of MOG gene Lentiviral packaging; S3: Construction of a cell line (MOG-293T cell line) overexpressing the MOG gene; S4: Preparation of cell slide components. The kit includes cell slide assembly, anti-human IgG-FITC secondary antibody, blocking solution, PBS and mounting medium; the kit can be used for detection of MOG autoimmune IgG antibody in clinical samples. The kit of the invention has the advantages of simple operation, strong detection specificity, high sensitivity, good repeatability of experimental results, can be popularized and applied, and can be used for detection of MOG autoimmune IgG antibody in clinical samples.

Description

technical field [0001] The invention relates to the fields of autoimmune diseases in the fields of biology and medicine and clinical autoimmune IgG antibody detection and analysis, in particular to a kind of indirect immunofluorescence detection (cell-based assays, CBA) kit preparation based on cells and clinical blood samples, cerebrospinal fluid The CBA rapid detection technology of MOG autoimmune antibodies in samples is an effective method for quickly completing the detection of MOG autoimmune antibodies, that is, the present invention specifically relates to a CBA detection kit for the detection of MOG autoimmune IgG antibodies in clinical samples. The preparation of the cell slide assembly, the CBA detection kit and its application. Background technique [0002] Myelin Oligodendrocyte Glycoprotein (Myelin Oligodendrocyte Glycoprotein, MOG) is composed of 218 amino acids and is a member of the immunoglobulin superfamily. It is specifically expressed in the central nervo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N5/10G01N33/68
CPCC12N15/86C12N5/0686C12N2509/00C12N2740/15043G01N33/6854G01N2333/70503
Inventor魏世辉艾南平
OwnerGENERAL HOSPITAL OF PLA