Intelligent thermostatic amplification technology based salmonella detection primer group, kit and method

A constant temperature amplification, Salmonella technology, applied in the field of molecular biology, can solve the problems of high technical level requirements of testing personnel, difficulty in realizing rapid testing promotion, expensive testing instruments, etc., and achieves overcoming genetic polymorphism detection and accurate genetic polymorphism Sex, the effect of short detection time

Inactive Publication Date: 2017-12-01
JINAN UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these detection technologies require high technical level of detection personnel, and the detection instruments required by these technologies are expensive and the detection cycle is long, so it is difficult to achieve the purpose of rapid detection and promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Intelligent thermostatic amplification technology based salmonella detection primer group, kit and method
  • Intelligent thermostatic amplification technology based salmonella detection primer group, kit and method
  • Intelligent thermostatic amplification technology based salmonella detection primer group, kit and method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Establishment of Salmonella Intelligent Constant Temperature Amplification Detection Kit

[0035] Intelligent constant temperature amplification detection kit for Salmonella, including intelligent constant temperature amplification primer set, intelligent constant temperature amplification reaction solution, Bst DNA polymerase, mismatch binding protein Tap Muts, positive control and negative control, fluorescent chromogenic reagent.

[0036](1) Design of intelligent constant temperature amplification primers: design primers with the Salmonella invA gene as the target gene. The primer sequences are listed in Table 1.

[0037] Table 1 Primer sequence list

[0038] Primer name

Primer sequence (5'-3')

FP

TTTATATATATATAAAGTTATTGGCGATAGCC (SEQ ID NO: 1)

TP

AGCCTGGCGGTTGGACCACGGTGACAATAG (SEQ ID NO: 2)

BP

GGTTTTGTTGTCTT (SEQ ID NO: 3)

OP1

CGCCACGTTCGGGCAATT (SEQ ID NO: 4)

OP2

TTTGGTAATAACGATAAA (SEQ...

Embodiment 2

[0042] Example 2 uses the ESE-Quant tube scanner to establish a Salmonella detection method:

[0043] The method utilizing the test kit of embodiment 1 to detect Salmonella comprises the steps:

[0044] (1) Extraction of DNA from the sample to be tested: extract DNA from the sample using a bacterial DNA extraction kit;

[0045] (2) Constant temperature gene amplification reaction: 25 μL reaction system contains 1.6 μmol / L of TP and FP primers, 0.8 μmol / L of BP primers, 0.5 μmol / L of OP1 and OP2 primers, 0.5 mmol / L of dNTPs, and 0.6 μmol / L of betaine mol / L, (NH4)2SO4mmol / L, MgCl2 2.5mmol / L, KCl 10mmol / L, MgSO42mmol / L, Green I 0.5μL, Tris-HCl with pH 8.8 20mmol / L, 0.2% 20. 6U Bst DNA polymerase, 1 μg Tap Muts, 1 μL DNA template, make up to 25 μL with deionized water; set positive control and negative control; mix the prepared PCR tube, centrifuge, and react at 63 ° C for 40 min.

[0046] (3) Judgment of results: Place the reaction tube in the ESE-Tube Scanner for reaction, ...

Embodiment 3

[0047] Embodiment 3 specificity experiment

[0048] Using the method of Example 2 to separate and purify Listeria monocytogenes ATCC19115 / 413, Salmonella ATCC14028, Staphylococcus aureus ATCC6538, Escherichia coli O157ATCC43889, Enterobacter sakazakii ATCC29544, Pseudomonas aeruginosa ATCC9027, Escherichia coli ATCC25922, Escherichia coli CMCC44102, Enterobacter sakazakii ATCC12868, Vibrio parahaemolyticus ATCC17802, Vibrio vulnificus ATCC27562, Staphylococcus aureus CMCC26003, Shigella baumannii CMCC51346, Shigella sonnei NICP51334, Proteus vulgaris NICPB490059, The DNA of Proteus mirabilis HB7131, Klebsiella CMCC (B) 46117, and Micrococcus luteus CMCC28001 were detected.

[0049] The identification results showed that Salmonella ATCC14028 was amplified normally, and the DNA of other bacteria and the negative control were not amplified. showed good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is an intelligent thermostatic amplification technology based salmonella detection primer group, kit and method. The primer group includes a TP primer, an FP primer, a BP primer, an OP1 primer and an OP2 primer; the kit comprises primer liquid, reaction liquid, Bst DNA polymerase, mismatch binding protein, a color developing agent and contrasts; the method includes: performing amplification on a sample DNA template at 63 DEG C by extracting to-be-detected DNA, utilizing DNA polymerase activity with chain replacement activity and adopting four specific primers and the mismatch binding protein, and pg-rate in the DNA can be detected; the identification mode lies in that SYBR Green I is added to a reaction system, whether amplification is performed or not is judged through an ESE-tube scanner instrument, and whether the samples contain salmonella DNA or not is determined. The intelligent thermostatic amplification technology based salmonella detection primer group, kit and method has the advantages of rapidness and efficiency, convenience in operation, high specificity, high flexibility, convenience in identification, fitness for field detection and the like and is suitable for promoted application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a primer set, a kit and a method for detecting Salmonella based on an intelligent constant temperature amplification technology. Background technique [0002] Salmonella is a common and important zoonotic pathogen, which is of great significance in public health. Salmonella is the main enteric pathogenic bacteria, which can easily cause food poisoning. In my country, food poisoning caused by Salmonella occupies the first place in bacterial food poisoning. At present, the detection method of Salmonella in food still adopts conventional biological culture and identification method supplemented by antigen and antibody immunological detection technology, pathogenic microorganism isolation and culture, physiological and biochemical identification, serotyping and immunoenzyme and other phenotypic characteristic detection methods. The method is cumbersome, time-consuming and l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11
CPCC12Q1/6844C12Q1/689C12Q2531/119C12Q2563/107Y02A50/30
Inventor叶蕾石磊闫鹤陈洵常彦磊
OwnerJINAN UNIVERSITY