Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of luciferase

A technology of luciferase and luciferase gene, which is applied in the field of Pichia pastoris protein expression system to express luciferase, can solve the problems of cumbersome steps and high cost of antibiotics, and achieve the effects of simple extraction, increased fragmentation efficiency, and reduced degradation

Inactive Publication Date: 2017-12-15
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to: overcome the problems of traditional luciferase live extraction technology such as long period, cumbersome steps, and high cost of inducers and antibiotics for producing luciferase in Escherichia coli, and provide a luciferase based on Pichia pastoris protein expression system The method has the advantages of short cycle, simple conditions and low cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of luciferase
  • Preparation method of luciferase
  • Preparation method of luciferase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0046] 1. Construction of firefly luciferase-expressing bacteria:

[0047] Primers were designed from the purchased vector pGL2-control

[0048] luc-F: CC GGATCC ATGGAAGACGCCAAAAACATAAAG;

[0049] luc-R:TA GCGGCCGC TTACAATTTGGACTTTCCGCCC, for PCR amplification.

[0050] Amplification conditions: 96°C for 10 min; 96°C for 40 s, 60°C for 40 s, 72°C for 2 min, 35 cycles; finally 72°C for 8 min.

[0051] The AvrII and NotI double restriction enzyme digestion amplified and purified PCR product was ligated with the vector pPIC9K, purified again with a DNA purification kit, and then ligated with T4 ligase. Heat shock at 42°C to transform competent Escherichia coli DH5α, smear LB agar medium (50 μg / mL kanamycin), culture and select colonies for expansion and send them to the sequencing company for sequencing. The correct transformant extracts the plasmid and names it as pPIC9K-luc, such as figure 1 shown.

[0052] Prepare Pichia pastoris GS115 competent cells with ice-cold 1m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of luciferase. The method comprises the following steps: cloning of a luciferase gene and construction of an expression vector; conversion of pichia pastoris with the luciferase expression vector; screening of a transformant; expression of the luciferase and extraction of crude enzyme liquids; separation and purification of the luciferase. The preparation method of the luciferase is simple and efficient, and has the advantages that culture condition requirements are simple, antibiotics are not required to be added to maintain gene stability, the inducer cost is low, the culture period is short and the like in a thallus culture process. The fusion luciferase which is 70 kDa large and provided with alpha-factor secretory peptide can be prepared with the method. In the preparation method, intracellular and extracellular crude enzyme liquids have better enzyme activity, the specific activity of crude enzymes after purification is up to 7.0*10<8> RLU / mg, the shake flask fermentation yield can reach 48 mg / L, and the novel method is provided for mass production of the luciferase and has good application prospect and market value.

Description

technical field [0001] The invention relates to the technical field of protein microbial expression, in particular to a method for expressing luciferase with a Pichia pastoris protein expression system. Background technique [0002] With the improvement of people's material living standards at home and abroad, food safety issues have become the focus of attention of all mankind. There are three main factors that cause food safety problems: biological factors, chemical factors and physical factors. Among them, the food safety problems caused by microbial contamination are particularly prominent. According to data released by the US CDC, 95% of food-borne poisoning incidents from 1998 to 2008 were caused by food-borne pathogenic microorganisms; according to China CDC statistics, the proportion of food poisoning caused by microorganisms from 2005 to 2011 accounted for 74%, Salmonella, Listeria Pathogenic bacteria such as special bacteria and Escherichia coli O157 are more lik...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/81C12N1/19C12R1/84
CPCC12N9/0069C12N15/815C12Y113/12007
Inventor 吴清平罗展浩张菊梅丁郁李程思吴慧清蔡芷荷卢勉飞
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com