A kind of tobacco nicotine content regulation gene ribosomal L4/L1 and its cloning method and application
A technology for regulating genes and nicotine, applied in the field of genetic engineering, can solve problems such as affecting nicotine content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Cloning Ribosomal L4 / L1 Gene
[0040] Tobacco leaf cDNA was used as a template, and primers were designed according to the tobacco genome database information, and the Ribosomal L4 / L1 PCR amplification of the gene to obtain the PCR amplification product. Design primers as follows:
[0041]Forward primer: 5'- CCGCTGCCGCCATTCCCACCCACCACCGTTC -3';
[0042] Reverse primer: 5'- GTGAAACAGCTCGTCCGGTACCCCATG -3'.
[0043] The PCR reaction system and amplification conditions are shown in Table 1.
[0044] Table 1 PCR reaction system and conditions
[0045]
[0046] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 shown. After electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.
Embodiment 2
[0047] Embodiment 2: the construction of plant RNAi vector
[0048] In Example 1 Ribosomal L4 / L1 The full-length fragment is used as a template, and the primers containing the gateway adapter sequence are used for PCR amplification. After the PCR product is purified, the amplified product is inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction ( figure 2 )middle. The constructed BP reaction carrier will be converted to Ribosomal L4 / L1 Fragment replacement into pHellsgate12 RNAi interference vector ( image 3 )middle.
[0049] (1) The gateway reaction primer sequence is as follows:
[0050] Ribosomal L4 / L1 _F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGAGGAGCCAACTCGATTAGTAG-3';
[0051] Ribosomal L4 / L1 _R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGTTCCCCTTTTTACCGCTTTTTG-3'.
[0052] (2) PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning.
[0053] The PCR reaction system and conditions were the same as in Example 1.
[00...
Embodiment 3
[0069] Example 3: Agrobacterium-mediated tobacco transformation and identification of transgenic plants
[0070] (1) Transformation of Agrobacterium by freeze-thaw method
[0071] Add 1 μg (200 ng / μL) of PB2GW7 recombinant vector to 100 μL of competent Agrobacterium LBA4404, mix well, let stand on ice for 5 min, freeze in liquid nitrogen for 5 min, and then take it out from the liquid nitrogen. Place in a water bath at 37°C for 5 minutes, then let stand on ice for 5 minutes, add 500 μL of LB solution, resume cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective plate culture cultured at 28°C for 48 h.
[0072] (2) Tobacco variety K326 was transformed by leaf disk method.
[0073] The specific method is as follows:
[0074] (a) Under aseptic conditions, put the tobacco K326 seeds into the EP tube and wash them with sterile water for 2-3 times;
[0075] (b) Soak in 75% alcohol for 30-60 s;
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


