Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of tobacco nicotine content regulation gene ribosomal L4/L1 and its cloning method and application

A technology for regulating genes and nicotine, applied in the field of genetic engineering, can solve problems such as affecting nicotine content

Active Publication Date: 2020-05-19
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Regulating nicotine synthesis genes through chloride channels to affect nicotine content has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of tobacco nicotine content regulation gene ribosomal L4/L1 and its cloning method and application
  • A kind of tobacco nicotine content regulation gene ribosomal L4/L1 and its cloning method and application
  • A kind of tobacco nicotine content regulation gene ribosomal L4/L1 and its cloning method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Cloning Ribosomal L4 / L1 Gene

[0040] Tobacco leaf cDNA was used as a template, and primers were designed according to the tobacco genome database information, and the Ribosomal L4 / L1 PCR amplification of the gene to obtain the PCR amplification product. Design primers as follows:

[0041]Forward primer: 5'- CCGCTGCCGCCATTCCCACCCACCACCGTTC -3';

[0042] Reverse primer: 5'- GTGAAACAGCTCGTCCGGTACCCCATG -3'.

[0043] The PCR reaction system and amplification conditions are shown in Table 1.

[0044] Table 1 PCR reaction system and conditions

[0045]

[0046] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 shown. After electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.

Embodiment 2

[0047] Embodiment 2: the construction of plant RNAi vector

[0048] In Example 1 Ribosomal L4 / L1 The full-length fragment is used as a template, and the primers containing the gateway adapter sequence are used for PCR amplification. After the PCR product is purified, the amplified product is inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction ( figure 2 )middle. The constructed BP reaction carrier will be converted to Ribosomal L4 / L1 Fragment replacement into pHellsgate12 RNAi interference vector ( image 3 )middle.

[0049] (1) The gateway reaction primer sequence is as follows:

[0050] Ribosomal L4 / L1 _F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGAGGAGCCAACTCGATTAGTAG-3';

[0051] Ribosomal L4 / L1 _R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGTTCCCCTTTTTACCGCTTTTTG-3'.

[0052] (2) PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning.

[0053] The PCR reaction system and conditions were the same as in Example 1.

[00...

Embodiment 3

[0069] Example 3: Agrobacterium-mediated tobacco transformation and identification of transgenic plants

[0070] (1) Transformation of Agrobacterium by freeze-thaw method

[0071] Add 1 μg (200 ng / μL) of PB2GW7 recombinant vector to 100 μL of competent Agrobacterium LBA4404, mix well, let stand on ice for 5 min, freeze in liquid nitrogen for 5 min, and then take it out from the liquid nitrogen. Place in a water bath at 37°C for 5 minutes, then let stand on ice for 5 minutes, add 500 μL of LB solution, resume cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective plate culture cultured at 28°C for 48 h.

[0072] (2) Tobacco variety K326 was transformed by leaf disk method.

[0073] The specific method is as follows:

[0074] (a) Under aseptic conditions, put the tobacco K326 seeds into the EP tube and wash them with sterile water for 2-3 times;

[0075] (b) Soak in 75% alcohol for 30-60 s;

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nicotine content controlling gene Ribosomal L4 / L1. The gene is used for coding polypeptide capable of controlling nicotine content in tobacco, wherein the amino acid sequence in the polypeptide is shown as SEQ ID: No.2; the nucleotide sequence in the nicotine content controlling gene Ribosomal L4 / L1 is shown as SEQ ID: No.1. The invention also discloses a cloning method and application of the controlling gene. The expression of the Ribosomal gene in the tobacco plant is inhibited, so that the nicotine content in the tobacco can be obviously decreased; the nicotine content controlling gene Ribosomal L4 / L1 has a good application prospect in actual production.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and further belongs to genes related to the synthesis and regulation of tobacco nicotine, in particular to a regulation gene of tobacco nicotine content Ribosomal L4 / L1 And its cloning method and application. Background technique [0002] It is very meaningful to study the metabolic regulation of tobacco nicotine. Through gene regulation, tobacco varieties with different nicotine content can be provided, which can provide raw materials for tobacco commercial production of personalized nicotine tobacco products. Nicotine has a strong physiological stimulating effect on the human body and is the material basis for the commercial use of tobacco. Many of the world's top tobacco companies such as Philip Morris, Imperial Tobacco, Japan Tobacco, British American Tobacco and other companies have invested heavily in research on the metabolic pathways and regulatory mechanisms of tobacco nicot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/10C12N15/82A01H5/12A01H6/82
CPCC07K14/415C12N15/1096C12N15/8218C12N15/8243C12Q2531/113
Inventor 白戈逄涛谢贺杨大海李勇姚恒李永平肖炳光张谊寒陈学军
Owner YUNNAN ACAD OF TOBACCO AGRI SCI