Gene detection probe and gene detection method

A gene detection and probe technology, applied in the field of biochemical analysis, can solve the problems of complex detection steps, slowness, and low hybridization efficiency, and achieve the effects of fast hybridization speed, simple and convenient operation, and high sensitivity

Active Publication Date: 2018-01-12
广州博徕斯生物科技股份有限公司
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the detection method based on nucleic acid probe hybridization has become a gold standard for gene analysis, it still faces the following problems: 1) The hybridization of nucleic acid probes requires a temperature shift process, for example, heat denaturation of gene amplification products is usually required After the nucleic acid is denatured, it becomes two single strands, and then the detection probe is specifically hybridized with the product, and then annealed to return to room temperature. Because the denaturation step requires a temperature controller, the detection step is complicated; 2) conventional nucleic acid Hybridization methods usually require high concentrations of hybridization probes, because usually high concentrations of probes need to be added so that the thermodynamic reaction equilibrium favors the direction of hybridization rather than the direction of annealing. In addition, even with high concentrations of probes, the hybridization The efficiency is also often very low, and this is because the length of the amplification product is often greater than the length of the probe, thereby causing a competition between the renaturation and hybridization of the nucleic acid; 3) conventional hybridization methods are usually slow, often taking more than an hour, Hybridization of target genes at low concentrations often requires overnight reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene detection probe and gene detection method
  • Gene detection probe and gene detection method
  • Gene detection probe and gene detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment one: Preparation of terpyridine ruthenium-N-hydroxysuccinimide ester (Ru(bpy) 3 2+ -NHS)

[0027] 1. Synthesis of terpyridine ruthenium hexafluorophosphate (Ru(bpy) 2 (dcbpy)(PF 6 ) 2 )

[0028] 0.2 g cis-dichlorobis(2,2'-bipyridyl)ruthenium(II), 0.15 g 2,2'-bipyridine-4,4'-dicarboxylic acid, 0.2 g sodium bicarbonate, 32 mL methanol and Add 8 mL of deionized water into a three-necked flask, install a condenser, heat to 80°C in a silicone oil bath under magnetic stirring, and heat to reflux for 10 hours. The reaction solution gradually changes from purple-brown to orange-red. After the reaction, adjust the pH value of the reaction solution to 4.4 with concentrated sulfuric acid, and cool down in an ice bath for 2 hours in a dark environment to precipitate excess 2,2'-bipyridine-4,4'-dicarboxylic acid , and then vacuum-filtered, and the filtrate was collected to obtain the carboxylated terpyridine ruthenium filtrate. Add 12.5 mL of sodium hexafluorophosp...

Embodiment 2

[0031] Embodiment 2: Ru(bpy) 3 2+ -NHS modification inactivates Cas9 protein

[0032] Add the inactivated Cas9 protein (dCas9 protein, purchased from Shanghai Tulo Harbor Biotechnology Co., Ltd.) to the weakly alkaline PBS buffer to make the final concentration 7 μM / L; add Ru(bpy) 3 2+ -NHS is added in DMF solvent, makes its final concentration be 2mmol / L; Then Ru(bpy) 3 2+ -NHS solution was added to the dCas9 protein solution, and ensured that Ru(bpy) 3 2+ -The molar ratio of NHS to dCas9 protein is 20:1. After slightly shaking and reacting for 1 hour under sealed and dark conditions, add 20 μL of glycine with a concentration of 2 mol / L and incubate for 15 minutes to terminate the reaction. Then equilibrate the reaction system with PBS buffer, and finally filter with Zeba centrifugal desalting column (40kDaMWCO) to remove unreacted Ru(bpy) 3 2+ -NHS. Collect the product Ru(bpy) 3 2+ -NHS-labeled dCas9 protein (dCas9-Ru(bpy) 3 2+ complex), then measure Ru(bpy) 3 ...

Embodiment 3

[0034] Example 3: Preparation of dCas9-Ru(bpy) 3 2+ / sgRNA probe

[0035] 1. Transcription of sgRNA

[0036] The present invention designs a T7 transcription system to transcribe sgRNA. The sgRNA sequence can be divided into two parts according to its function: one part is used to bind to the dCas9 protein to maintain the stability of the dCas9 / sgRNA system; the other part is the targeting region, which is used for gene search and targeting. According to the sequence of the target gene, design the downstream region of the T7 promoter so that the final transcribed RNA sequence contains the complete sequence of the sgRNA.

[0037] According to the fluorescent protein GFP gene sequence, design a pair of specific primers, as follows:

[0038] Forward primer: gaaattaatacgactcactatagggaaggaggacggcaacatcctgttttagagctagaaatagc; (the part in italics is the T7 promoter sequence, the underlined part is the GFP targeting sequence of sgRNA)

[0039] Reverse primer: aaaagcaccgactcggtgc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene detection probe and a gene detection method. The gene detection probe comprises inactivated nuclease protein, a marking molecule and guide RNA, and the marking moleculeand the guide RNA are connected to the inactivated nuclease protein which is inactivated Cas9 protein or inactivated Cpf1 protein. The gene detection method includes: subjecting a to-be-detected geneand the gene detection probe to incubation at the room temperature to obtain a gene-probe complex, and performing signal detection on the obtained gene-probe complex to realize gene detection. The gene detection probe can be hybridized with the to-be-detected gene at the normal temperature and is high in to-be-detected gene affinity and recognition specificity, high in hybridization speed and highin sensitivity, and quickness and accuracy in gene detection are realized.

Description

technical field [0001] The invention belongs to the technical field of biochemical analysis, and specifically relates to a gene detection probe and a gene detection method. Background technique [0002] Accurate, sensitive, and specific analysis of biological functional molecules (such as nucleic acids and proteins) is of great scientific significance in the fields of life science and biomedical research and clinical diagnosis of diseases. Conventional biochemical analysis and medical diagnosis have experienced the development of landmark technologies such as radiology, radioimmunology, and immuno-optics. In recent years, they have gradually transitioned to the category of molecular diagnostics. In the 21st century, thanks to multidisciplinary synthesis, nucleic acid probes and sensing technologies have achieved deeper and broader development. For example, through the development of immune-PCR (Immune-PCR) and aptamer probe technology, nucleic acid probes have been able to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6806C12Q1/682C12N15/11C12N9/22
Inventor李然刘晋峰苏玲玲
Owner广州博徕斯生物科技股份有限公司