A method for constructing recombinant adenovirus using anp or iganp gene, recombinant adenovirus and application
A technology of recombinant adenovirus and gene, applied in the direction of double-stranded DNA virus, virus, application, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] [Example 1] Obtaining the target gene ANP and IgANP
[0063] 1. Acquisition of proANP gene fragments
[0064] 1.1 Primer design
[0065] The gene sequence was obtained according to the GeneBank number NM_006172.3 of the human ANP gene, in which the CDS region has 456 bp, and the sequence is as follows:
[0066] ATGAGCTCCTTCTCCACCACCACCGTGAGCTTCCTCCTTTTACTGGCATTCCAGCTCCTAGGTCAGACCAGAGCTAATCCCATGTACAATGCCGTGTCCAACGCAGACCTGATGGATTTCAAGAATTTGCTGGACCATTTGGAAGAAAAGATGCCTTTAGAAGATGAGGTCGTGCCCCCACAAGTGCTCAGTGAGCCGAATGAAGAAGCGGGGGCTGCTCTCAGCCCCCTCCCTGAGGTGCCTCCCTGGACCGGGGAAGTCAGCCCAGCCCAGAGAGATGGAGGTGCCCTCGGGCGGGGCCCCTGGGACTCCTCTGATCGATCTGCCCTCCTAAAAAGCAAGCTGAGGGCGCTGCTCACTGCCCCTCGGAGCCTGCGGAGATCCAGCTGCTTCGGGGGCAGGATGGACAGGATTGGAGCCCAGAGCGGACTGGGCTGTAACAGCTTCCGGTACTGA。
[0067] According to the above gene sequence, Primer Premier 5 was used to design the following primers (Table 1). In ANP amplification primers, Kpn I restriction site is added to the upstream primer, and Xba I...
Embodiment 2
[0100] [Example 2] Preparation of recombinant adenovirus carrying ANP or secreted ANP gene
[0101] 1 Construction of recombinant adenovirus gene vector
[0102] 1.1 Construction and identification of pMD-20T-IgANP or pMD-20T-ANP vector
[0103] IgANP or ANP and pMD-20T vector connection system: Solution I 5 μL, pMD-20T vector 0.5 μL, overlapping IgANP or ANP recovery product 2.6 μL, ddH 2 O 1.9 μL.
[0104] The ligated system was placed in a thermostat at 16°C overnight. Kpn I, Xba I double enzyme digestion identification, the reaction product is electrophoresed with 1% agarose gel (such as figure 2 ). Sequencing identification was performed by Wuhan Sequencing Department of Sangon Bioengineering (Shanghai) Co., Ltd.
[0105] 1.2 Construction and identification of pAdTrack-IgANP or pAdTrack-ANP shuttle vector
[0106] IgANP or ANP and pAdTrack-CMV vector ligation system: T4 ligase Buffer 10×2 μL, T4 ligase 2 μL, IgANP or ANP recovery product 2 μL, pAdTrack-CMV 4 μL, dd...
Embodiment 3
[0179] [Example 3] Detection of tumor suppressor effect
[0180] 1. Cell scratch experiment
[0181] ① Cell preparation, the SCC9 cells in a 60mm dish with a confluence of about 70% were added with virus at a multiplicity of infection of 100 (pfu was about 1×10 9 Add 30 μL of virus), let stand at 37°C, 5% CO 2 cultured in an incubator.
[0182] ②Use a marker pen to draw two parallel lines at the bottom of each well of the 12-well plate in advance, suspend the cells in the 60mm dish yesterday with trypsin, and a 60mm dish with a confluence of about 70%-80% can be fully covered 4 wells of a 12-well plate (the cells infected with the virus grow slowly, adding the virus at 70% confluence will not cause too many cells when plated), place the 12-well plate with the cells at 37°C, 5%CO 2 Cultivated in an incubator;
[0183] ③ For cell scratch treatment, take an iron ruler that has been burned by an alcohol lamp. After it cools down, place it on the hole, fix it by hand, and use ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



