Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for constructing recombinant adenovirus using anp or iganp gene, recombinant adenovirus and application

A technology of recombinant adenovirus and gene, applied in the direction of double-stranded DNA virus, virus, application, etc.

Active Publication Date: 2020-11-03
WUHAN INST OF BIOENG
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Transdermal administration can avoid the direct degradation of protease and the removal of tissues and organs, but this method must overcome the barrier of the skin stratum corneum. In order to promote the entry of polypeptide drugs into the skin, iontophoresis is currently used more often, but most of this system is still In the laboratory stage, there are still some problems, such as: the current through the skin is limited by the strength and duration due to the physiological conditions of the skin; the determination of the mechanism of promoting penetration; the choice of transdermal drugs; the more practical and convenient introduction device , economics, etc. need to be further studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for constructing recombinant adenovirus using anp or iganp gene, recombinant adenovirus and application
  • A method for constructing recombinant adenovirus using anp or iganp gene, recombinant adenovirus and application
  • A method for constructing recombinant adenovirus using anp or iganp gene, recombinant adenovirus and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] [Example 1] Obtaining the target gene ANP and IgANP

[0063] 1. Acquisition of proANP gene fragments

[0064] 1.1 Primer design

[0065] The gene sequence was obtained according to the GeneBank number NM_006172.3 of the human ANP gene, in which the CDS region has 456 bp, and the sequence is as follows:

[0066] ATGAGCTCCTTCTCCACCACCACCGTGAGCTTCCTCCTTTTACTGGCATTCCAGCTCCTAGGTCAGACCAGAGCTAATCCCATGTACAATGCCGTGTCCAACGCAGACCTGATGGATTTCAAGAATTTGCTGGACCATTTGGAAGAAAAGATGCCTTTAGAAGATGAGGTCGTGCCCCCACAAGTGCTCAGTGAGCCGAATGAAGAAGCGGGGGCTGCTCTCAGCCCCCTCCCTGAGGTGCCTCCCTGGACCGGGGAAGTCAGCCCAGCCCAGAGAGATGGAGGTGCCCTCGGGCGGGGCCCCTGGGACTCCTCTGATCGATCTGCCCTCCTAAAAAGCAAGCTGAGGGCGCTGCTCACTGCCCCTCGGAGCCTGCGGAGATCCAGCTGCTTCGGGGGCAGGATGGACAGGATTGGAGCCCAGAGCGGACTGGGCTGTAACAGCTTCCGGTACTGA。

[0067] According to the above gene sequence, Primer Premier 5 was used to design the following primers (Table 1). In ANP amplification primers, Kpn I restriction site is added to the upstream primer, and Xba I...

Embodiment 2

[0100] [Example 2] Preparation of recombinant adenovirus carrying ANP or secreted ANP gene

[0101] 1 Construction of recombinant adenovirus gene vector

[0102] 1.1 Construction and identification of pMD-20T-IgANP or pMD-20T-ANP vector

[0103] IgANP or ANP and pMD-20T vector connection system: Solution I 5 μL, pMD-20T vector 0.5 μL, overlapping IgANP or ANP recovery product 2.6 μL, ddH 2 O 1.9 μL.

[0104] The ligated system was placed in a thermostat at 16°C overnight. Kpn I, Xba I double enzyme digestion identification, the reaction product is electrophoresed with 1% agarose gel (such as figure 2 ). Sequencing identification was performed by Wuhan Sequencing Department of Sangon Bioengineering (Shanghai) Co., Ltd.

[0105] 1.2 Construction and identification of pAdTrack-IgANP or pAdTrack-ANP shuttle vector

[0106] IgANP or ANP and pAdTrack-CMV vector ligation system: T4 ligase Buffer 10×2 μL, T4 ligase 2 μL, IgANP or ANP recovery product 2 μL, pAdTrack-CMV 4 μL, dd...

Embodiment 3

[0179] [Example 3] Detection of tumor suppressor effect

[0180] 1. Cell scratch experiment

[0181] ① Cell preparation, the SCC9 cells in a 60mm dish with a confluence of about 70% were added with virus at a multiplicity of infection of 100 (pfu was about 1×10 9 Add 30 μL of virus), let stand at 37°C, 5% CO 2 cultured in an incubator.

[0182] ②Use a marker pen to draw two parallel lines at the bottom of each well of the 12-well plate in advance, suspend the cells in the 60mm dish yesterday with trypsin, and a 60mm dish with a confluence of about 70%-80% can be fully covered 4 wells of a 12-well plate (the cells infected with the virus grow slowly, adding the virus at 70% confluence will not cause too many cells when plated), place the 12-well plate with the cells at 37°C, 5%CO 2 Cultivated in an incubator;

[0183] ③ For cell scratch treatment, take an iron ruler that has been burned by an alcohol lamp. After it cools down, place it on the hole, fix it by hand, and use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a recombinant adenovirus by utilizing an ANP (Atrial Natriuretic Peptide) or IgANP gene, the recombinant adenovirus and application. A recombinant adenovirus vector is constructed by taking the ANP as a target gene; the vector is used for expressing an ANP polypeptide in a tongue carcinoma cell SCC9; meanwhile, a signal peptide sequence of immune globulin is added in front of an ANP sequence to construct the secretory type ANP polypeptide. The tongue carcinoma cell is infected by the recombinant adenovirus; RT-PCR (Reverse Transcription-Polymerase Chain Reaction) proves that the ANP or IgANP can be expressed in the tongue carcinoma cell SCC9; MTT (Methyl Thiazolyl Tetrazolium) cell relative activity detection and a cell scratch experiment prove that the ANP has the effect of inhibiting the tongue carcinoma cell SCC9 activity and migration in an in vitro experiment, and the acting effect of the IgANP is more obvious, so that the growth of the tongue carcinoma cell is inhibited. The method has the advantages of high efficiency and large yield; the invention provides an unreported gene treatment system for resisting tumor cell migration and growth.

Description

technical field [0001] The invention relates to a method for constructing a recombinant adenovirus, specifically, a method for constructing a recombinant adenovirus by using ANP or IgANP gene, the recombinant adenovirus and its application in the preparation of drugs for inhibiting the activity of tongue cancer cells. Background technique [0002] Tongue cancer is a common malignant tumor in the oral and maxillofacial region, more than 98% of which are squamous cell carcinomas, and its biological characteristics are mainly manifested as local invasion and cervical lymph node metastasis. Patients with tongue squamous cell carcinoma have a high rate of cervical lymph node metastasis, and early cervical lymph node metastasis is prone to occur. The prognosis of patients with cervical lymph node metastasis is significantly worse than that of patients without cervical lymph node metastasis. Cervical lymph node metastasis is an important factor leading to the death of patients with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/861C12N15/16C12N7/01A61K38/22A61K48/00A61P35/00A61P1/02
CPCA61K38/2242A61K48/005C07K14/58C12N7/00C12N15/86C12N2710/10321C12N2710/10343C12N2710/10352Y02A50/30
Inventor 张军林岳硕豪赵志扬谢立兰赖晓晶程烨李毅
Owner WUHAN INST OF BIOENG