Method for producing 1,3-propanediol from whole-cell mixed conversion glycerinum
A cell transformation and whole cell technology, applied in the field of bioengineering, can solve the problems of low tolerance of substrate glycerol, difficulty in separation and purification, and high production cost, so as to avoid the separation and purification process of enzymes, simple culture conditions, and improve utilization rate effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Construction of Genetically Engineered Bacteria with High 1,3-Propanediol Oxidoreductase Activity
[0028] (1) According to the 1,3-propanediol oxidoreductase gene sequence and the characteristics of the multiple cloning site of the expression vector pET-28a, use bioinformatics software to design and synthesize primers: primer1:5- ACAGCAGCGGCCTGGTGCCGCGAATTTTAAATTAAAAGGAGAA-3, primer2: 5'- GGTGGTGGTGGTGCTCGAGT TTGAATTCTTTAAATATTAT-3', primer1 and primer2 underlined and passed Nhe I and Hind III The linearized pET-28a sequence is complementary.
[0029] (2) Using Clostridium butyricum genomic DNA as a template, the target gene was amplified by PCR.
[0030] (3) PCR reaction parameters: pre-denaturation, 95°C 5min; denaturation, 94°C 2min; annealing, 55°C 30sec; extension: 72°C 90sec; cycle: 30; stop extension: 72°C 10min.
[0031] (4) The obtained PCR product was detected by 1% agarose gel electrophoresis, and an electrophoretic band with a size of about 1.2Kb ...
Embodiment 2
[0039] Preparation of 1,3-propanediol by mixed transformation of whole cells
[0040] (1) Take Clostridium butyricum XYB11 stored at -80°C in 5 mL of seed medium, and culture it statically at 37°C for 12 hours in anaerobic culture to obtain Clostridium butyricum XYB11 seed liquid. Seed medium includes: yeast extract 3g / L, beef extract 10g / L, tryptone 10g / L, glucose 5g / L, soluble starch 1g / L, sodium chloride 5g / L, sodium acetate trihydrate 3g / L , cysteine hydrochloride 0.15g / L.
[0041] (2) The Clostridium butyricum XYB11 seed solution obtained in step (1) was inoculated into the expansion medium at an inoculum amount of 10%, and left to stand for anaerobic culture at 37°C for 12 hours to obtain the Clostridium butyricum XYB11 bacterial solution. The expansion medium includes: yeast extract 3g / L, beef extract 10g / L, tryptone 10g / L, glucose 5g / L, soluble starch 1g / L, sodium chloride 5g / L, sodium acetate trihydrate 3g / L , cysteine hydrochloride 0.15g / L.
[0042] (3) Centri...
Embodiment 3
[0047] Change the concentration of glycerol in the cell transformation fluid component in step (5) of Example 2 to 20 g / L or 80 g / L, and the conditions for other conversions to prepare 1,3-propanediol and the method for measuring the conversion rate are completely the same as in Example 2 same.
[0048] When the concentration of glycerol in the cell transformation liquid components was 20 g / L, the conversion liquid components were detected by high performance liquid chromatography, and the conversion rate of glycerol to 1,3-propanediol was measured to be 84.9%.
[0049] The concentration of glycerol in the cell transformation solution was 80 g / L. The conversion rate of glycerol to 1,3-propanediol was 77.1% when the conversion solution was detected by high performance liquid chromatography.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More