Gene editing system, expression vector, gene editing kit and application thereof
A technology of gene editing and expression vectors, applied in the field of gene editing systems, can solve the problems of susceptible X4-tropic HIV, carcinogenesis, knockout of CCR5, etc., and achieve the effect of improving the efficiency of homologous recombination and solving safety risks
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 High-efficiency gRNA screening of CRISPR-Cas9 knockout CCR5 gene
[0054] 1. gRNA preparation
[0055] (1) Design a 20nt gRNA sequence according to the sequence of the CCR5 gene (including the exon and the intron sequence adjacent to the exon), the 3'-end of the target sequence of the gRNA on the CCR5 gene is NGG;
[0056] (2) Synthesize the sense strand and antisense strand of the target sequence with cohesive ends respectively (cacc is added to the 5'-end of the sense strand, if the first nucleotide at the 5'-end of the sense strand is not guanine G, add cacc to the sense strand Add caccG at the 5'-end of the antisense strand; add aaac at the 5'-end of the antisense strand, if the first nucleotide at the 5'-end of the sense strand is not guanine G, add C at the 3'-end of the antisense strand );
[0057] (3) The above-mentioned sense strand and antisense strand were mixed, treated at 90°C, cooled naturally to room temperature for annealing treatment, and do...
Embodiment 2
[0084] Example 2 Construction of Donor Vector for Site-directed Integration of Membrane Fusion Inhibiting Peptide DNA Sequence at CCR5 Site
[0085] 1. Construction of pDonor-EF1α-maC46-hCCR5F86 (insert fragment 5kb)
[0086] (1) Obtaining the upstream homology arm of CCR5F86 and constructing the pDonor-TALEN-EGFP-hCCR5F86-F expression vector
[0087] 1. PCR amplification of the target fragment F86-F;
[0088] Primers F86-SnaB I-L / F86-Sal I-R were used to amplify the F86-F target fragment using the HepG2 cell genome as a template.
[0089] F86-SnaB I-L (SEQ ID NO:7): 5'-gttctagtggttggctacgtagcaccatgcttgacccagtttc-3'
[0090] F86-Sal I-R (SEQ ID NO: 8): 5'-tagcttatcgataccgtcgacGTCACCACCCCAAAGGTGAC-3'
[0091] The obtained PCR product sequence contains the DNA sequence SEQ ID NO:9 of the F86 upstream homology arm;
[0092] gcaccatgcttgacccagtttcttaaaattgttgtcaaagcttcattcactccatggtgctatagagcacaagattttatttggtgagatggtgctttcatgaattcccccaacagagccaagctctccatctagtggacagggaagctagcag...
Embodiment 3
[0174] Example 3 Selection and optimization of the size of the inserted sequence for homologous recombination
[0175] 1. The Hela cell line was cultured on a 24-well plate with a plating density of 1.2×10^5 cells / well and cultured with DMEM medium (adding 10% FBS);
[0176] 2. Extract plasmids pDonor-EF1α-maC46-hCCR5F86(5kb), pDonor-EF1α-maC46-hCCR5F86-mini(3kb), pDonor-mCMV-maC46-hCCR5F86(1.6kb) and pX458 with endotoxin-free extraction kit -F86;
[0177] 3. Using Lipofectamine 3000Transfection Reagent, transform pX458-F86 and the above three homologous recombination plasmids into Hela cells respectively;
[0178] 4. From the fifth day, add G418 with a final concentration of 800μg / ml for screening, passaging once every 3-5 days, and replace each time with fresh DMEM medium containing 800μg / ml G418;
[0179] 5. On the 14th day of G418 screening, perform flow sorting, sort single cells into a 96-well plate, and put them in 37°C, 5% CO 2 and 95% relative humidity in an incuba...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


