Kit for identifying and diagnosing potato leaf-roll virus in tobacco vein spot and assay method thereof

A leaf-roll virus, differential diagnosis technology, applied in the directions of microorganism-based methods, biochemical equipment and methods, and microorganism determination/inspection, can solve the problem that tobacco virus pathogens cannot fully reflect the virus, etc., to improve operability , save time, overcome the effect of cumbersome steps

Inactive Publication Date: 2018-07-24
王涛 +3
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Due to the phenomenon of compound infection of multiple viruses in the tobacco vein spot disease sample, the identification of tobacco virus pathogens with obvious symptoms by traditional serology, PCR and other methods cannot fully reflect the virus in the sample, so there is an urgent need for a Kit for differential diagnosis of Potatovirus in tobacco vein spot and its detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for identifying and diagnosing potato leaf-roll virus in tobacco vein spot and assay method thereof
  • Kit for identifying and diagnosing potato leaf-roll virus in tobacco vein spot and assay method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0023] (1) Primer design and synthesis

[0024] According to the results of high-throughput sequencing analysis of tobacco small RNA, the specific primers of tobacco mosaic virus in the tobacco vein spot disease were designed and synthesized: SPLVGV-1 (CCAGTCAAACCCGAACAAAGGA) and SPLVGV-2 (GGCATAGCGTGCTAAACCCAG);

[0025] (2) Extraction of total RNA

[0026] Polypeptide polyphenol plant tissue lysis method

[0027] (3) RT-PCR

[0028] a. cDNA synthesis by reverse transcription

[0029] Tobacco total RNA is used as template, SPLVGV-2 primer is used, and cDNA is synthesized by reverse transcriptase as MLV. The reverse transcription system is:

[0030]

[0031]

[0032] Gently flick the tube wall to mix well, after a little centrifugation, keep warm at 42°C for 60 minutes, and then put it on ice for use;

[0033] b.PCR amplification

[0034] cDNA

[0035] The PCR program is: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute, annealing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a kit for identifying and diagnosing the potato leaf-roll virus in tobacco vein spot, which comprises two specific primers, and the kit further comprises M-MLV reverse transcriptase, M-MLV enzyme reaction buffer solution, dNTPs, Taq DNA polymerase, Mg<2+> and PCR (polymerase chain reaction) buffer solution. The invention further provides an assay method for tobacco vein spot virus, which comprises the following steps: (1) the total RNA of a sample to be assayed is extracted; (2) the primers are designed and synthesized; (3) RT-PCR (reverse transcription-polymerase chainreaction) is carried out; (4) electrophoretic assay is carried out. Since the kit for identifying and diagnosing the potato leaf-roll virus in the tobacco vein spot and the assay method which are provided by the invention utilizes the RT-PCR method to assay the potato leaf-roll virus in the tobacco vein spot, the complex steps of separating the nucleic acid of the tobacco virus are overcome, timeis saved, the operability, sensitivity and repeatability of assay are greatly increased, and an effective method is provided for the prevention and control of the tobacco vein spot virus and the assay of virus-free seedlings.

Description

technical field [0001] The invention belongs to the technical field of plant virus detection, and in particular relates to a kit for differential diagnosis of potato leafroll virus in tobacco vein spot disease and a detection method thereof. Background technique [0002] Tobacco vein spot disease is mainly caused by the infection of Potato virus Y (PVY), and is often associated with Cucumber mosaic virus (CMV), Tobacco etch virus (TEV), and Tobacco vein mottle virus. One or more of viruses such as virus (TVMV) and Tobacco necrosis virus (TNV) compound infect tobacco strains. The viruses in the tobacco vein spot samples belonged to the genus Tobamovirus, the genus Potyvirus and the genus Polerovirus respectively. [0003] Due to the phenomenon of compound infection of multiple viruses in tobacco vein spot disease samples, the identification of tobacco virus pathogens with obvious symptoms by traditional serology, PCR and other methods cannot fully reflect the virus in the sa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/686C12R1/94
CPCC12Q1/686C12Q1/701C12Q2521/107C12Q2565/125
Inventor 王涛岳金波秦永刚丁维
Owner 王涛
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap