Kit for identifying and diagnosing potato leaf-roll virus in tobacco vein spot and assay method thereof
A leaf-roll virus, differential diagnosis technology, applied in the directions of microorganism-based methods, biochemical equipment and methods, and microorganism determination/inspection, can solve the problem that tobacco virus pathogens cannot fully reflect the virus, etc., to improve operability , save time, overcome the effect of cumbersome steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0023] (1) Primer design and synthesis
[0024] According to the results of high-throughput sequencing analysis of tobacco small RNA, the specific primers of tobacco mosaic virus in the tobacco vein spot disease were designed and synthesized: SPLVGV-1 (CCAGTCAAACCCGAACAAAGGA) and SPLVGV-2 (GGCATAGCGTGCTAAACCCAG);
[0025] (2) Extraction of total RNA
[0026] Polypeptide polyphenol plant tissue lysis method
[0027] (3) RT-PCR
[0028] a. cDNA synthesis by reverse transcription
[0029] Tobacco total RNA is used as template, SPLVGV-2 primer is used, and cDNA is synthesized by reverse transcriptase as MLV. The reverse transcription system is:
[0030]
[0031]
[0032] Gently flick the tube wall to mix well, after a little centrifugation, keep warm at 42°C for 60 minutes, and then put it on ice for use;
[0033] b.PCR amplification
[0034] cDNA
[0035] The PCR program is: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 1 minute, annealing ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com