Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate as well as application thereof

A CYP82E10, nicotine conversion rate technology, applied in the field of genetic engineering, can solve the problem of reducing the nicotine conversion rate of flue-cured tobacco

Active Publication Date: 2018-08-21
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, so far there are few studies on the synthesis of demethylated nicotine in flue-cured tobacco. Whether the synthesis mechanism of flue-cured tobacco and Burley tobacco is consistent has not been reported in the literature. How to reduce the conversion rate of flue-cured tobacco nicotine still needs to be explored

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate as well as application thereof
  • CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate as well as application thereof
  • CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Creation of flue-cured tobacco mutant library

[0019] 1. EMS treatment of flue-cured tobacco seeds

[0020] Seeds of flue-cured tobacco (variety: Yunyan 87) were soaked in 50% commercially available bleach solution for 12 minutes, then quickly washed with deionized water, and soaked in deionized water for 12 hours. Discard deionized water and add an equal volume of 0.5% EMS (ethyl methanesulfonate) for 12 hours. Discard the treatment solution, add deionized water to wash 6-8 times, about 1 minute each time. The seeds were collected in a Buchner funnel and drained for later use.

[0021] 2. Field planting of M1 plants

[0022] After EMS treatment, the seeds are sown on floating trays, one seed per hole, and transplanted to the field after emergence, and managed with normal agronomic measures. After budding, single plant was bagged and harvested to obtain M2 seeds.

[0023] 3. Mutant Genomic DNA Extraction and Sample Mixing

[0024] Use the kit to extract genomic D...

Embodiment 2

[0028] CYP82E10 Gene Mutant Screening

[0029] 1. Tilling primers

[0030] CYP82E10 The gene has two exons, and the mutants in the first exon region were screened by Tilling technique. According to the genome sequence of the target gene,

[0031] The forward primer is CYP82E10 _Tilling_F:GTCAAATACCACCTCTTAATAGTAA,

[0032] The reverse primer is CYP82E10 _Tilling_R: AAAAGTCCCTATTGGTAGGAAGTGC.

[0033] 2. PCR amplification conditions

[0034] The PCR reaction system is as follows: the total volume is 10 μL, including 1.0 μL of 20 ng / μL DNA sample, 1.0 μL of 10×PCR buffer, 0.8 μL of dNTPs, 0.16 μL of each primer, 0.1 μL of Taq DNase, and 6.78 μL of ddH2O.

[0035] The PCR reaction program is as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 30 seconds; Anneal at ℃ for 30 seconds, extend at 72℃ for 90 seconds, run 40 cycles; finally extend at 72℃ for 5 minutes. PCR amplification products can be stored at 4°C.

[0036] 3. Enzyme digestion a...

Embodiment 3

[0041] CYP82E10 Gene missense mutation verification

[0042] 1. Genomic DNA extraction and PCR amplification of M3 generation mutants

[0043] According to the Tilling screening results of the M2 generation plants, select CYP82E10 Seeds (M3 generation) of a single plant with mutations in the gene target region were sown in seedling trays. The genomic DNA of seedling leaves was extracted by kit method. by CYP82E10 _Tilling_F and CYP82E10 _Tilling_R primer, amplified with genomic DNA as a template CYP82E10 The first exon region of the gene. The PCR reaction system is as follows: the total volume is 25 μL, including 1.0 μL of 20 ng / μL DNA sample, 2.5 μL of 10×PCR buffer, 2 μL of dNTPs, 0.5 μL of each primer, 0.3 μL of Taq DNase, ddH 2 O 18.2 μL. The PCR reaction program is as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds (1°C drop per cycle), extension at 72°C for 90 seconds, and 30 cycles; exte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate as well as application thereof. Relative to a CYP82E10 gene as shown in the nucleotide sequence SEQ ID NO.1, C at the 342 site in the CYP82E10 gene sequence which the CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate contains is replaced by T, point mutation occurs, and the nucleotide sequence of the CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate is as shown in SEQ ID NO.2. The CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate is applied to a tobacco plant with low nicotine conversion rate. In a cloud and mist 87 material which is obtained by the CYP82E10 gene missense mutant M594 capable of reducing nicotine conversion rate, the nicotine conversion rate of the leaf is reduced by about 55 percent compared with that of the control, and the conversion rate of the nicotine is obviously reduced.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a CYP82E10 gene missense mutant M594 which reduces the conversion rate of nicotine and its application. Background technique [0002] Nicotine, nornicotine, anabasine, and anatabine are tobacco ( Nicotiana tobacum ), among which nicotine is the main alkaloid, accounting for 90-95% of the total alkaloid content, and the content of demethylated nicotine is usually lower than 3.5% of the total alkaloid, which is the conversion of nicotine through demethylation reaction generate. Nornicotine can be harmful to human health, mainly because it is the synthetic precursor of the potential carcinogen nitrosonornicotine (NNN) in cigarette smoke, which may lead to the occurrence of esophageal cancer and oral cancer. Nornicotine can also directly induce abnormal glycosylation of proteins in the plasma of smokers. Studies have also shown that it can covalently react w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02A01H5/00A01H6/82
CPCC12N9/0071C12N15/8243
Inventor 李文正宋中邦李梅云王丙武高玉龙吴兴富隋学艺赵璐李永平
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com