Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting TMAO (trimethylamine oxide) by enzyme method and application thereof

A technology of trimethylamine oxidation and enzymatic method, which is applied in the direction of material excitation analysis, fluorescence/phosphorescence, etc., can solve the problems of expensive instruments, unsuitable high-throughput analysis and screening, and limitations

Active Publication Date: 2018-09-07
THE SECOND HOSPITAL OF SHANDONG UNIV
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mass spectrometry and NMR methods are very sensitive for detecting TMAO, but the instruments are expensive, labor-intensive, time-consuming and costly, and not suitable for high-throughput analysis and screening
[0003] The traditional luciferase assay system based on resazurin has the advantages of high sensitivity, simple operation, low cost, and rapid detection. However, since there is no dehydrogenase NAD-dependent participation in the metabolic pathway of TMAO, there is no such method that uses TMAO as a substrate. Therefore, it cannot be directly based on the dehydrogenase-diaphorase coupling assay protocol, which limits the possibility of directly using dehydrogenases to perform luciferase assays for TMAO

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting TMAO (trimethylamine oxide) by enzyme method and application thereof
  • Method for detecting TMAO (trimethylamine oxide) by enzyme method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0152] A method for enzymatic detection of trimethylamine oxidized TMAO, using a multi-enzyme combination system of TMAO demethylase tdm, formaldehyde dehydrogenase fadh, formate dehydrogenase fdh and diaphorase to realize the fluorescence measurement of TMAO;

[0153] Wherein the coding gene sequence of TMAO demethylase tdm is:

[0154] ATGAATGTTAATGCGGCGGCCCCAAAGGGGTCGTTCGACCTGGACGCGCCCCGGCGCGTCCAGACCCTTTCGGCGGCGGGCGGCGGCGGGGTTCAGTTCGACCTTTCGGCCGGCGACGAAGCGATCATTACAAATCTCGAGGGGGGCCAGGCCGGCGAATTGCTGACCGCCTCCGGCGAGCCACTCCGGCTCACGCCGGGGTCGGCGCCGACCGACGAGGCCGGCGTCCGCGCCGTCGCGGGCGATCTCGCCGCCGCGTTCCTCGCCGCGCGGCAGGGAACCGAACGGTTTCTGGCGACGCCGCTTTTTCATGCCGCCGCGGAGCCGGGCGAAACCTTCCGCTTCAAGGCCGAGGCCGATATGCGCTGCCTTCTATTGGCGCCCGGCGAGCCGATGGCCCCCGACGCGCAGAATCCACCGACGGAACTGCGCCTCGATATTTTCTCAAGCCGGCCGACGGGCGGCGCCGCGCCGCCTTCGCTTGCCCCAGTAAAGCTCGATCTCAGGGTCGACGCCGCAACCGCGCGCGCTTATCGCGTCAGCGCCGGCGATTATATCCAGATCATCGACGTGGACGGCCGGCAATGCTCCGATCTCGTCGCCTTCGACGCCAGGGCCCTGGCTGAGGGCCGCGAGCTTGGCGTCGATCCGAC...

Embodiment 2

[0162] A method for enzymatic detection of trimethylamine oxide TMAO, comprising the following steps:

[0163] (1) Exogenous expression and separation and purification of protein:

[0164] (1) Combining sequence comparison and analysis means, select the coding gene of TMAO demethylase tdm, the coding gene of formaldehyde dehydrogenase fadh and the coding gene of formate dehydrogenase fdh, and then synthesize the target genes through the whole gene respectively to obtain TMAO demethylase methylase tdm target gene, formaldehyde dehydrogenase fadh target gene and formate dehydrogenase fdh target gene;

[0165] (2) The TMAO demethylase tdm target gene, the formaldehyde dehydrogenase fadh target gene and the formate dehydrogenase fdh target gene obtained in step (1) were respectively connected into the pETDuet-1 expression vector by molecular cloning, and transformed into Escherichia coli BL21(DE3) In the strain, when OD600=0.6, add 1mM IPTG, induce expression at 20°C, 180rpm for ...

Embodiment 3

[0181] Except the proportion composition of every 10ml mixed solution, all the other conditions are consistent with embodiment 2;

[0182] The proportion composition of every 10ml mixture is NAD + , 60μl; resazurin, 20μl; 10mg / ml purified TMAO demethylase tdm target protein, 220μl; 20mg / ml purified formaldehyde dehydrogenase fadh target protein, 260μl; 20mg / ml purified Formate dehydrogenase fdh target protein, 260μl; diaphorase, 4mg; add HEPES solution to make up to 10ml.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting TMAO (trimethylamine oxide) by an enzyme method and application thereof. The detection method utilizes a multi-enzyme combination system containing TMAOTDM (demethylase), FADH (formaldehyde dehydrogenase), FDH (formate dehydrogenase) and diaphorase, so as to perform fluorescence determining on the TMAO; the method can be used for developing a TMAO detection kit. The method for detecting the TMAO by the enzyme method has the advantages that the defect of failure to directly determine based on dehydrogenase and diaphorase coupling because of no participation of NAD dependence dehydrogenase in the metabolism path of the TMAO is overcome; by adopting the multi-enzyme coupling of TDM-FADH-FDH-diaphorase, the system for fluorescence determining ofthe TMAO is constructed, and one TMAO molecule is decomposed into two fluorescence signals; the sensitivity is high, the detection is rapid and stable, the repeatability is good, the operation is simple and convenient, and the cost is lower.

Description

technical field [0001] The invention relates to the technical field of enzymatic detection, in particular to a method for enzymatic detection of trimethylamine oxide TMAO and its application. Background technique [0002] At present, the methods for detecting trimethylamine oxide TMAO mainly include spectrophotometry, gas chromatography, ion chromatography, capillary electrophoresis, gas chromatography-mass spectrometry, etc. The reproducibility of capillary electrophoresis is relatively poor, and the analysis sensitivity of GC-MS is high. It is suitable for the analysis of low molecular volatile compounds and has high separation efficiency. It can be used for quantitative analysis of complex mixtures, but derivatization and solid-phase microextraction of samples are required. Pre-processing, the operation is cumbersome. Some researchers used high-performance liquid chromatography tandem mass spectrometry, using deuterated TMAO as an internal standard, and selected multiple...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N21/64
CPCG01N21/64
Inventor 张文唐东起江淼王芳刘江
Owner THE SECOND HOSPITAL OF SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More