Method for detecting TMAO (trimethylamine oxide) by enzyme method and application thereof
A technology of trimethylamine oxidation and enzymatic method, which is applied in the direction of material excitation analysis, fluorescence/phosphorescence, etc., can solve the problems of expensive instruments, unsuitable high-throughput analysis and screening, and limitations
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0152] A method for enzymatic detection of trimethylamine oxidized TMAO, using a multi-enzyme combination system of TMAO demethylase tdm, formaldehyde dehydrogenase fadh, formate dehydrogenase fdh and diaphorase to realize the fluorescence measurement of TMAO;
[0153] Wherein the coding gene sequence of TMAO demethylase tdm is:
[0154] ATGAATGTTAATGCGGCGGCCCCAAAGGGGTCGTTCGACCTGGACGCGCCCCGGCGCGTCCAGACCCTTTCGGCGGCGGGCGGCGGCGGGGTTCAGTTCGACCTTTCGGCCGGCGACGAAGCGATCATTACAAATCTCGAGGGGGGCCAGGCCGGCGAATTGCTGACCGCCTCCGGCGAGCCACTCCGGCTCACGCCGGGGTCGGCGCCGACCGACGAGGCCGGCGTCCGCGCCGTCGCGGGCGATCTCGCCGCCGCGTTCCTCGCCGCGCGGCAGGGAACCGAACGGTTTCTGGCGACGCCGCTTTTTCATGCCGCCGCGGAGCCGGGCGAAACCTTCCGCTTCAAGGCCGAGGCCGATATGCGCTGCCTTCTATTGGCGCCCGGCGAGCCGATGGCCCCCGACGCGCAGAATCCACCGACGGAACTGCGCCTCGATATTTTCTCAAGCCGGCCGACGGGCGGCGCCGCGCCGCCTTCGCTTGCCCCAGTAAAGCTCGATCTCAGGGTCGACGCCGCAACCGCGCGCGCTTATCGCGTCAGCGCCGGCGATTATATCCAGATCATCGACGTGGACGGCCGGCAATGCTCCGATCTCGTCGCCTTCGACGCCAGGGCCCTGGCTGAGGGCCGCGAGCTTGGCGTCGATCCGAC...
Embodiment 2
[0162] A method for enzymatic detection of trimethylamine oxide TMAO, comprising the following steps:
[0163] (1) Exogenous expression and separation and purification of protein:
[0164] (1) Combining sequence comparison and analysis means, select the coding gene of TMAO demethylase tdm, the coding gene of formaldehyde dehydrogenase fadh and the coding gene of formate dehydrogenase fdh, and then synthesize the target genes through the whole gene respectively to obtain TMAO demethylase methylase tdm target gene, formaldehyde dehydrogenase fadh target gene and formate dehydrogenase fdh target gene;
[0165] (2) The TMAO demethylase tdm target gene, the formaldehyde dehydrogenase fadh target gene and the formate dehydrogenase fdh target gene obtained in step (1) were respectively connected into the pETDuet-1 expression vector by molecular cloning, and transformed into Escherichia coli BL21(DE3) In the strain, when OD600=0.6, add 1mM IPTG, induce expression at 20°C, 180rpm for ...
Embodiment 3
[0181] Except the proportion composition of every 10ml mixed solution, all the other conditions are consistent with embodiment 2;
[0182] The proportion composition of every 10ml mixture is NAD + , 60μl; resazurin, 20μl; 10mg / ml purified TMAO demethylase tdm target protein, 220μl; 20mg / ml purified formaldehyde dehydrogenase fadh target protein, 260μl; 20mg / ml purified Formate dehydrogenase fdh target protein, 260μl; diaphorase, 4mg; add HEPES solution to make up to 10ml.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com