Unlock instant, AI-driven research and patent intelligence for your innovation.

Single cell whole genome amplification method

A gene amplification and single-cell technology, applied in the field of genetic engineering, can solve problems such as the uniformity and coverage of amplified products, and achieve the effects of improving uniformity and coverage, reducing amplification preference, and shortening the operation process

Active Publication Date: 2018-09-28
VAZYME BIOTECH NANJING
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, MDA is the same as DOP-PCR, and it is still an exponential amplification, so there is still a sequence preference in the PCR reaction, especially the significant non-specific amplification, and often the blank control sample always produces a large amount of DNA "out of nothing", especially When the initial amount of amplified template is small, the uniformity and coverage of the amplified product decrease, and there is still a certain allele drop-out (ADO)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single cell whole genome amplification method
  • Single cell whole genome amplification method
  • Single cell whole genome amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1, construct the vector containing Phi29 mutant

[0043] Synthetic primers are as follows:

[0044] R45H-F: GTTTATGGCATGGGTGTTGAAGGTACAA

[0045] R45H-R: ACACCCATGCCATAAACTCATCCAGGC

[0046] G197D-F: GTCTAAAAgatTTCAAGGATATTATAACCACTAAGAAATTC

[0047] G197D-R: ATCTTTTAGACTGTCACTGCCTGCTG

[0048] Using the plasmid containing the gene sequence of the wild-type Phi29 DNA polymerase as a template, the wild-type Phi29 DNA polymerase was amplified by PCR. The PCR amplification was divided into two reactions, using R45H-F and G197D-R, G197D-F and R45H-R as primers respectively, and using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novozyme Co., Ltd., Vazyme, Cat. No. P505 ) is a polymerase, and the reaction system is 50 μl. The amplification conditions were 95°C for 30s, 95°C for 15s, 60°C for 15s, 70°C for 30s, and 72°C for 5min, a total of 30 cycles.

[0049] After amplification, 1 μl DpnI was directly added to the 50 μl reaction system, and incubated a...

Embodiment 2

[0050] Example 2 Single-cell Whole Genome Amplification Method

[0051] 1. Single cell isolation

[0052] Collect cell line samples or tissue samples, prepare a single cell suspension, and dilute to 5-7×10 with PBS 2 cells / ml, take 150 μl of cell suspension on a glass slide, place it on an inverted microscope stage, adjust the focus, use a pipette to aim at the single cell to be selected under the lens, and gently suck it, the volume is about 1 μl, and put Single cells were transferred to 3 μl of PBS solution.

[0053] 2. Single-cell whole-genome amplification

[0054] The Buffer D, Buffer N, DTT, and phi29 DNA polymerase used in this step were all provided by the Discover-sc single cell Kit (N601) kit of Vazyme, Nanjing.

[0055] The sample used was a single cell, which was resuspended in 4 μl of PBS, and another 1 ng of 293 g DNA was taken as a positive control, and sterilized water was used as a negative control.

[0056] (1) Prepare bufferD2

[0057]

[0058] (2) A...

Embodiment 3

[0070] 1. Sample preparation

[0071] On the third day of the blastocyst biopsy, a small hole is made in the zona pellucida of the embryo, and then culture is continued so that the trophectoderm cells can grow out. On the fifth day, 3-5 cells can be obtained for subsequent expansion.

[0072] 2. Whole genome amplification and sequencing

[0073] Using the method described in Example 2, the traditional MDA amplification system, and the MALBCA system, 5 trophectoderm cells were used to amplify the whole genome, and the amplified product was diluted 10 times with sterile water and then the Equalbit dsDNA HS Assay Kit (Vazyme , #EQ111) for concentration determination, take 5ng amplification product with TruePrep DNA Library Prep KitV2for (Vazyme, #TD502) for fragmentation and library construction. The library was adsorbed with VAHTS DNA Clean Beads (N411) produced by Nanjing Vazyme Biotechnology Co., Ltd., the magnetic beads were washed with 80% ethanol, and the beads were washe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a single cell whole genome amplification method. The single cell whole genome amplification method comprises the following steps of 1) separating a cell sample into 1-10 cells;2) lysing single cells, then adding gene amplification mixtures and a mutant Phi129 DNA (deoxyribonucleic acid) polymerase for amplification reaction; 3) fragmenting, purifying and then sequencing amplification products, wherein the gene amplification mixtures is composed of one or more of 5-8 mM of MnCl2, 0.5-1 mM of Na2HPO4, 50-100 ng of bovine serum albumin (BSA) or 0.1-0.5% by volume percentage of glycerin, and the amino acid sequence of the mutant Phi29 DNA polymerase is shown as SEQ ID NO.1. compared with traditional MDA (multiple displacement amplification) systems, the single cell whole genome amplification method further improves uniformity and coverage, and can be applied to precise detection of SNP (single nucleotide polymorphism) and DNA copy number variation as well as to preimplantation embryo genetic diagnosis and screening.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a single-cell whole gene amplification method. Background technique [0002] With the continuous development of next-generation sequencing technology and the continuous reduction of sequencing costs, large-scale whole-genome sequencing technology has greatly promoted rapid whole-genome DNA sequence analysis and genotyping. General whole-genome sequencing requires a large number of For the study of the heterogeneity of cancer cells, cell behavior, etc., the experimental results often represent an average value, or the dominant cell information, while the characteristics of individual cells are often ignored; for The genomic DNA of very precious clinical samples and microbial samples that are difficult to cultivate is extremely small. In order to make up for this limitation, single-cell sequencing came into being. [0003] Compared with traditional whole-genome sequenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6869C12N15/11C12N9/12
CPCC12N9/1252C12Q1/6869C12Y207/07007C12Q2531/113
Inventor 聂俊伟曹林张力军瞿志鹏韩锦雄叶廷跃
Owner VAZYME BIOTECH NANJING