Single cell whole genome amplification method
A gene amplification and single-cell technology, applied in the field of genetic engineering, can solve problems such as the uniformity and coverage of amplified products, and achieve the effects of improving uniformity and coverage, reducing amplification preference, and shortening the operation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Embodiment 1, construct the vector containing Phi29 mutant
[0043] Synthetic primers are as follows:
[0044] R45H-F: GTTTATGGCATGGGTGTTGAAGGTACAA
[0045] R45H-R: ACACCCATGCCATAAACTCATCCAGGC
[0046] G197D-F: GTCTAAAAgatTTCAAGGATATTATAACCACTAAGAAATTC
[0047] G197D-R: ATCTTTTAGACTGTCACTGCCTGCTG
[0048] Using the plasmid containing the gene sequence of the wild-type Phi29 DNA polymerase as a template, the wild-type Phi29 DNA polymerase was amplified by PCR. The PCR amplification was divided into two reactions, using R45H-F and G197D-R, G197D-F and R45H-R as primers respectively, and using Phanta Max Super-Fidelity DNA Polymerase (Nanjing Novozyme Co., Ltd., Vazyme, Cat. No. P505 ) is a polymerase, and the reaction system is 50 μl. The amplification conditions were 95°C for 30s, 95°C for 15s, 60°C for 15s, 70°C for 30s, and 72°C for 5min, a total of 30 cycles.
[0049] After amplification, 1 μl DpnI was directly added to the 50 μl reaction system, and incubated a...
Embodiment 2
[0050] Example 2 Single-cell Whole Genome Amplification Method
[0051] 1. Single cell isolation
[0052] Collect cell line samples or tissue samples, prepare a single cell suspension, and dilute to 5-7×10 with PBS 2 cells / ml, take 150 μl of cell suspension on a glass slide, place it on an inverted microscope stage, adjust the focus, use a pipette to aim at the single cell to be selected under the lens, and gently suck it, the volume is about 1 μl, and put Single cells were transferred to 3 μl of PBS solution.
[0053] 2. Single-cell whole-genome amplification
[0054] The Buffer D, Buffer N, DTT, and phi29 DNA polymerase used in this step were all provided by the Discover-sc single cell Kit (N601) kit of Vazyme, Nanjing.
[0055] The sample used was a single cell, which was resuspended in 4 μl of PBS, and another 1 ng of 293 g DNA was taken as a positive control, and sterilized water was used as a negative control.
[0056] (1) Prepare bufferD2
[0057]
[0058] (2) A...
Embodiment 3
[0070] 1. Sample preparation
[0071] On the third day of the blastocyst biopsy, a small hole is made in the zona pellucida of the embryo, and then culture is continued so that the trophectoderm cells can grow out. On the fifth day, 3-5 cells can be obtained for subsequent expansion.
[0072] 2. Whole genome amplification and sequencing
[0073] Using the method described in Example 2, the traditional MDA amplification system, and the MALBCA system, 5 trophectoderm cells were used to amplify the whole genome, and the amplified product was diluted 10 times with sterile water and then the Equalbit dsDNA HS Assay Kit (Vazyme , #EQ111) for concentration determination, take 5ng amplification product with TruePrep DNA Library Prep KitV2for (Vazyme, #TD502) for fragmentation and library construction. The library was adsorbed with VAHTS DNA Clean Beads (N411) produced by Nanjing Vazyme Biotechnology Co., Ltd., the magnetic beads were washed with 80% ethanol, and the beads were washe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


