A type A Seneca virus virus-like particle and its preparation method and application

A virus-like, virus technology, applied in positive-sense single-stranded RNA viruses, biochemical equipment and methods, viruses, etc., can solve problems such as non-infectivity, and achieve the effect of improving assembly efficiency

Active Publication Date: 2019-12-24
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Virus-like particle (VLPs) vaccine is a form of vaccine that does not use live virus, but its immunogenicity is almost the same as that of inactivated virus. It is an empty shell structure without viral nucleic acid, and is similar in shape and structure to natural virus particles. Not infectious as it does not contain viral genetic material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A type A Seneca virus virus-like particle and its preparation method and application
  • A type A Seneca virus virus-like particle and its preparation method and application
  • A type A Seneca virus virus-like particle and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The preparation of embodiment 1SVA virus-like particle

[0054] 1. Construction of small ubiquitin-like modified protein fusion expression vectors pSMA, pSMK and pSMC:

[0055] (1) Using Saccharomyces cerevisiae genomic DNA as a template and using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:

[0056] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3'

[0057] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3',

[0058] (2) After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with ampicillin resistance Gene or chloramphenicol resistance gene, get vector pSMA and pSMC;

[0059] 2. Construction of SVA structural protein gene recombinant expression vector

[0060] According to the published SVA sequence (GenBank accession number: NC_011349), the codons wer...

Embodiment 2

[0085] The immunogenicity research of embodiment 2SVA virus-like particles

[0086]The antigen for immunization was emulsified with Freund's adjuvant according to the instructions. Fifteen guinea pigs weighing about 300 grams were randomly divided into 3 groups. The first group was immunized with VLPs (prepared in Example 1), the second group was immunized with unassembled proteins, and the third group was injected with PBS as a control. Blood was collected 28 days after immunization to separate serum, and antibody titers and neutralizing antibodies were detected.

[0087] (1) ELISA detection of antibody titer

[0088] A 96-well ELISA plate was coated overnight at 4° C. with 100 μL of SVA hyperimmune serum diluted in 0.05 M sodium carbonate buffer (pH 9.6). Wash with PBST for 3 times, then incubate with SVA virus solution at 37°C for 1 h, wash with PBST for 3 times, and block the well plate with PBST (100 μL) containing 5% skimmed milk powder at 37°C for 1 h. After washing ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to view more

Abstract

A virus-like particle of Senecavirus A, the particle including a structural protein VP0, a structural protein VP1 and a structural protein VP3. The structural protein VP0 is encoded by a gene sequence represented by SEQ ID NO: 1. The structural protein VP1 is encoded by a gene sequence represented by SEQ ID NO: 2. The structural protein VP3 is encoded by a gene sequence represented by SEQ ID NO: 3.

Description

technical field [0001] The invention relates to a type A Seneca virus virus-like particle, a preparation method and application thereof, and belongs to the technical field of agricultural science, animal husbandry and veterinary medicine. Background technique [0002] Senecavirus A (SVA), also known as Seneca Valley virus (SVV), belongs to the family Picornaviridae Senecavirus. The SVA genome is about 7.2kb long, and it is a single-stranded positive-sense RNA virus without an envelope. The virus particles are typical icosahedral symmetry, and the diameter is about 27nm. In 2002, a company in the United States accidentally discovered SVA in cell cultures. SVA was initially considered to be a contaminant in cell cultures, presumably derived from pig pancreatic enzymes or fetal bovine serum. In 2007, SVA was found to be the causative agent of porcine idiopathic vesicular disease (PIVD) in Canada. In 2014, several severe infection symptoms appeared in Brazil, which caused huge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/04C12N15/70C07K14/085C12Q1/70A61K39/125A61P31/14C12R1/93
CPCA61K39/12A61K2039/5258A61K2039/552A61P31/14C07K14/005C12N7/00C12N15/70C12N2770/32022C12N2770/32023C12N2770/32034C12Q1/70G01N2333/085A61K2039/575C07K16/1009C07K2317/76A61K35/76A61K39/39C12N15/86
Inventor 郭慧琛孙世琪韩世充董虎郭笑然殷宏罗建勋
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap