NAC transcription factor related to fruit top hardening of golden pear
A transcription factor, gold technology, applied in the field of plant genetic engineering, can solve problems such as thickening of fruit skin, intolerance to storage, affecting fruit appearance quality, eating quality and storage quality, and achieve the effect of improving fruit quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Example 1: Cloning and expression pattern analysis of golden pear transcription factor NAC gene
[0016] 1. Obtaining and sequencing analysis of PpNAC gene cDNA
[0017] The sequence of the predicted ORF region of the PpNAC gene was obtained by transcriptome sequencing, and the primers for cloning were designed using Premier 5.0 software. , the cDNA obtained by reverse transcription of the extracted golden pear RNA was used as a template for PCR amplification, and the PCR product was subjected to agarose gel electrophoresis ( figure 1 ), the specific fragments were separated and recovered, and then the recovered products were connected with the PMD19-T vector to transform the E. coli liquid of positive clones, and after identification, they were sent to Qingdao Qingke Zixi Biotechnology for sequencing.
[0018] According to the homology comparison between the PpNAC amino acid sequence obtained by sequencing and the different plant NAC genes obtained by searching in the...
Embodiment 2
[0024] Example 2: Subcellular localization of PpNAC
[0025] 1. Choose a fresh yellow onion, peel off the outer 3-4 layers of scales, peel off the inner scales of the onion on the ultra-clean workbench, and use a scalpel to cut the inner epidermis into 1 cm 2 For the left and right squares, use tweezers to peel off the inner epidermis, spread the peeled side down on 1 / 2 MS solid medium, and culture in the dark at 28 °C for 24 h;
[0026] 2. Preparation of infection solution: Take the previously preserved Agrobacterium bacteria solution (pCAMBIA1300-NAC and empty vector pCAMBIA1300) in LB liquid medium (containing 100 mg / L Kan and 100 mg / L Rif), and place it at a constant temperature of 28 ℃ Shake at 200 rpm on a shaker until OD 600 0.6, transferred to a 50 mL centrifuge tube and centrifuged at 5000 rpm for 10 min, collected the bacteria, discarded the supernatant and resuspended twice with an equal volume of 1 / 2MS liquid medium containing 20 mg / L acetosyringone (AS) , taking...
Embodiment 3
[0030] Embodiment 3, fruit transient expression detection
[0031] 1. Construction of pSuper1300-PpNAC vector
[0032] Primer design: PpNAC upstream: 5' GCGAAGCTTATGTCTTTCCTCCATGGCATCCTCAG (HindⅢ) 3', PpNAC downstream: 5' GCGGGTACCTCACTTTGGTACTCCATCTACAACG (KpnI) 3'.
[0033]PCR amplification was carried out according to the designed primers, the recovered product was connected to pMD19 and then transformed into Escherichia coli, after the plasmid DNA was extracted, the plasmid was digested, and the restriction endonucleases HindⅢ and KpnI were selected as double enzymes after analysis by DNAMAN software Endonucleases were used for the test, and a 20 μL system was used for the enzyme digestion test, and the components were as follows: 1 μL of HindⅢ, 1 μL of KpnI, 2 μL of 1×M Buffer, 6 μL of plasmid DNA, and 10 μL of H2O. After adding the system to a 200 μL centrifuge tube, shake it gently to mix and centrifuge briefly, then incubate at 37 °C for 2 h, and add 10×Loading Buffer...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More