Polypeptide nano bubbles as well as preparation method and application thereof

A nanobubble and microbubble technology, applied in the field of polypeptide nanobubble and its preparation, can solve the problems of poor biocompatibility and weak targeting, and achieve the effects of stable properties, significant advantages and improved utilization.

Active Publication Date: 2018-11-02
NANJING MEDICAL UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Purpose of the invention: In order to solve the problems of weak targeting, poor stability and poor biocompatibility of existing drugs for treating obesity, the first aspect of the present invention provides a method for preparing polypeptide nanobubbles, and the second aspect of the present invention provides The polypeptide nanobubbles prepared by the preparation method, the third aspect of the present invention provides the application of polypeptide nanobubbles, by encapsulating drugs (such as: nucleic acids, proteins, lipids, sugars, ketones and other drugs) and different drug delivery Drugs (such as: intravenous injection, subcutaneous or intraperitoneal injection, etc.) targeted treatment of obesity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide nano bubbles as well as preparation method and application thereof
  • Polypeptide nano bubbles as well as preparation method and application thereof
  • Polypeptide nano bubbles as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Preparation of polypeptide nanobubble and polypeptide nanobubble-curcumin preparation

[0028] Experimental plasmid: The company purchased the vector plasmid containing the EGFP reporter gene as pIRES2-EGFP, and its map is shown in figure 1 shown.

[0029] Experimental steps:

[0030] 1) Using pIRES2-EGFP as a carrier, construct a recombinant plasmid containing Flag tag, targeting polypeptide CKGGRAKDC and CD63 gene; the detailed steps are as follows:

[0031] 1.1 Primer Design

[0032]Design specific PCR primers according to the CDS sequence of CD63 and the MCS site of the pIRES2-EGFP expression vector: the nucleotide sequence of primer CD63-F is shown in SEQ ID NO: 1, and the nucleotide sequence of primer CD63-R is shown in shown in SEQ ID NO:2. CD63-F contains XhoI restriction site (CTCGAG), Flag tag sequence (GATTACAAGGATGACGACGATAAG) and adipose tissue targeting polypeptide CKGGRAKDC sequence (TGTAAGGGAGGAAGAGCGAAGGATTGT); CD63-R contains EcoRI restri...

Embodiment 2

[0089] Example 2 Polypeptide nanobubble-curcumin formulation can effectively inhibit the weight gain of high-fat-fed mice

[0090] Experimental animals: 6-week-old male mice and feed were provided by the Experimental Animal Center of Nanjing Medical University, license number: SCXK (Su) 2011-0003. Animals were housed in random cages with free water and water.

[0091] Experimental drugs: normal diet control group (blank control group); high-fat diet was divided into normal saline group (model control group), nanobubble group, nanobubble-curcumin group, and polypeptide nanobubble group (step 3 from Example 1) prepared), curcumin group and polypeptide nanobubble-curcumin group (prepared by step 4 of Example 1).

[0092] Among them, the preparation steps of nanobubbles are as follows: inoculate 293T cells (ATCC, product number: CM-H010) into the cell culture medium, place at 37°C, 5% CO 2 Culture in an incubator to a density of 70-90% (approximately 0.25-1 x 10 6 cells), colle...

Embodiment 3

[0098] Example 3 Polypeptide nanobubble-curcumin formulation can significantly inhibit the storage of visceral fat and subcutaneous fat in high-fat-fed mice

[0099] 1) According to the experimental procedure of Example 2, high-fat-fed obese mice were administered intravenously for 20 weeks;

[0100] 2) The mice in each group were fasted for 12 hours, anesthetized by intraperitoneal injection of 3% sodium pentobarbital, 45 mg / kg, and weighed accurately;

[0101] 3) Routine disinfection and laparotomy were performed, and the adipose tissue around the kidney, the adipose tissue around the mesentery, the adipose tissue around the epididymis, and the subcutaneous adipose tissue in the abdomen were quickly removed and weighed for wet weight (among them, the subcutaneous adipose tissue in the abdomen: the abdomen below the costal arch and above the groin) , bounded by the midaxillary line on both sides);

[0102] 4) Calculated according to the following formula, namely: abdominal f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of polypeptide nano bubbles. The method comprises the following steps that a recombinant plasmid is constructed, wherein the recombinant plasmid comprisesa Flag tag, adipose tissue targeting polypeptide and a coding gene of nano bubble marker membrane protein CD63; the recombinant plasmid is transfected into a cell which secretes nano bubbles through lipidosome for culture, cell culture fluid is collected, and through ultracentrifugation, the polypeptide nano bubbles are extracted. The invention further discloses the polypeptide nano bubbles and application in preparing an obesity treatment medicine thereof. By means of the polypeptide nano bubbles, great convenience is provided for anti-obesity medicine targeting treatment, the polypeptide nano bubbles not only have high medicine loading capacity, but also have good biological compatibility, and a loaded medicine is wrapped in the polypeptide nano bubbles, so that not only does the medicine have good biological compatibility, but also the stability of the medicine in the body is obviously enhanced, cycling time of the medicine in the body is prolonged, the utilization rate of the medicine is greatly improved, and the targeting anti-obesity activity of the medicine is significantly enhanced.

Description

technical field [0001] The invention relates to nanobubbles and applications thereof, in particular to a polypeptide nanobubble and a preparation method and application thereof. Background technique [0002] With the improvement of people's living standards, the number of obese people is increasing year by year. According to the World Health Organization, as a chronic metabolic disease, obesity has become one of the top five risks of death in the world. tumor etc. Therefore, intervention therapy for obesity is an important measure to prevent and treat obesity-related diseases. [0003] To date, the main treatments for obesity are dietary behavior therapy, surgery and drug therapy. For dietary behavior therapy, when weight loss is stopped, the weight will rebound severely, even exceeding the weight before weight loss. And surgical procedures (eg: gastric retraction, gastric bypass, gastric banding) are too risky. Therefore, many obese patients take drug therapy as their ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K47/42A61K9/50A61K45/00A61P3/04
CPCA61K9/5052A61K45/00A61P3/04A61K9/5169A61K9/5192A61K31/12C07K14/47C07K14/70596C07K2319/33C07K2319/43A61K47/6925C07K2319/60
Inventor张亚琴韩晓吴金道袁毅庞晶许茹凤李宏卫武和明浦立勇
OwnerNANJING MEDICAL UNIV