Unlock instant, AI-driven research and patent intelligence for your innovation.

Trichoderma reesei and application thereof to production of tannase

A technology of Trichoderma reesei and tannase, applied in the field of genetic engineering, can solve the problems of low yield of production strains, restrictions on wide application, and few species, and achieve the effects of promoting promotion and application, reducing production costs, and increasing expression

Active Publication Date: 2018-11-06
WEIFANG KANGDIEN BIOTECH +1
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are relatively few types of tannase products on the market, and due to the low yield of the production strains, the price of the enzyme remains high, which seriously limits the wide application of the enzyme in food, feed and other fields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma reesei and application thereof to production of tannase
  • Trichoderma reesei and application thereof to production of tannase
  • Trichoderma reesei and application thereof to production of tannase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Cloning of Tannase Gene and Construction of Recombinant Plasmid

[0019] According to the codon preference of Trichoderma reesei, the applicant optimized the codon of the tannase gene derived from Aspergillus oryzae, adding 6 bases TCTAGA (Xba I restriction site) before the first amino acid codon. Point), after the stop codon TAA, add TCTAGA (Xba I restriction site), the optimized nucleotide sequence is SEQ ID NO: 2, synthesized by Shanghai Jierui Company, and the encoded amino acid sequence is SEQ ID NO:1.

[0020] PCR amplification of the above-mentioned tannase gene. The primer sequence is as follows:

[0021] Primer 1 (F): GC TCTAGA ATGCGCCAGCACTCCCGCATG

[0022] Primer 2(R): GC TCTAGA TTAGTAGACGGGGACCTTGAA

[0023] The PCR reaction conditions were: denaturation at 94°C for 5 minutes; then denaturation at 94°C for 30s, renaturation at 56°C for 30s, extension at 72°C for 110s, 30 cycles, and incubation at 72°C for 10 minutes. The results of agarose gel elec...

Embodiment 2

[0030] Example 2 Construction of Trichoderma reesei recombinant strain

[0031] 1. Protoplast preparation:

[0032] Inoculate the host cells of Trichoderma reesei on PDA+U (potato 200g / L, boil for 20-30min, filter to remove residue; glucose 2%; Uridine 1%; agar powder 1.5%) plate, culture at 30℃ for 5-7 days; harvest A 2cm×2cm bacterial block, inoculate 100ml of liquid PDA+U (potato 200g / L, boil for 20-30min, filter to remove residue; glucose 2%; Uridine1%) medium, culture at 30℃ for 16h to grow mycelium Transformation; after filtering the grown mycelium, resuspend it with 20ml 1.2M magnesium sulfate solution; add 0.2g lysozyme and incubate at 30℃ and 100rpm for 2-3h; filter the lysed mycelium with 2 layers of lens cleaning paper Centrifuge at 3000 rpm for 10 minutes to obtain protoplasts; filter the lysed hyphae with lens cleaning paper and centrifuge to obtain protoplasts; then resuspend with appropriate amount of sorbitol solution.

[0033] 2. Conversion:

[0034] The T. reesei p...

Embodiment 3

[0038] Example 3 Mutagenesis Screening

[0039] The mutations caused by UV mutagenesis are very random, and the effects of mutations are also random and difficult to predict. Therefore, in order to obtain effective positive mutations, technicians usually need to perform multiple rounds of ultraviolet mutagenesis, which requires a large amount of screening work, and there is a possibility that effective positive mutations cannot be obtained. However, because UV mutagenesis requires simple equipment, low cost, and a large number of mutants can be obtained in a short time, it is still a commonly used method of mutagenesis.

[0040] The applicant used Trichoderma reesei 4QT as the starting strain, and genetically modified it through the ultraviolet mutagenesis method to further improve its tannase production.

[0041] 1. Determine the fatality rate:

[0042] Inoculate the starting bacterium Trichoderma reesei 4QT on a PDA plate, and culture at 30°C for 5-7 days. When a large number of s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a mutant strain trichoderma reesei capable of producing high-yield tannase. The mutant strain trichoderma reesei was preserved in China Center for Type Culture Collection (CCTCC) of Wuhan University in China on June 21, 2018, and the preservation number is CCTCC NO:M2018389. The invention also provides the application of the mutant strain trichoderma reesei to production of the tannase. The mutant strain trichoderma reesei can greatly increase the expression quantity of the tannase; after 20L tank fermentation is conducted for 160 hours, the enzyme activity of the tannase in the mutant strain fermentation supernatant is up to 158 u / ml and is increased by 56.4 percent compared with that of the original strain, and the unanticipated effect is achieved. The mutant strain trichoderma reesei can be widely applied to the production of the tannase, so that the production cost of the tannase is reduced and popularization and application in the fields of food and feed processing and the like are promoted.

Description

Technical field [0001] The present invention relates to the technical field of genetic engineering, and specifically relates to a Trichoderma reesei and its application in the production of tannase. Background technique [0002] The full name of tanninase is tannin acyl hydrolase (Tannase, EC 3.1.1.20), which can hydrolyze the ester bond and the carboxyl bond of depsip in gallic acid tannin to generate gallic acid and glucose. Tanninase is widely distributed in nature. The earlier report on tannase was in the 1920s. When Freudenberg was cultivating Aspergillus niger, it was found to contain tannase in its hyphae. Later, various microorganisms, including Fungi, yeast, and bacteria can all produce tannase; tannase is also present in some plant materials, such as tea extracts. Tanninase can be widely used in food industry, fine chemical industry and other fields. [0003] In the production of liquid tea and instant tea, because polyphenols, caffeine, protein and other substances for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N13/00C12N9/18C12R1/885
CPCC12N9/18C12N13/00C12Y301/0102
Inventor 徐晓东李瑞王贵斌黄亦钧
Owner WEIFANG KANGDIEN BIOTECH