Recombinant pseudomonas putida and application

A technology for the preservation of Pseudomonas putida and strains, which is applied in the field of fermentation engineering, can solve the problems of unfriendly environment and toxicity, and achieve the effects of less environmental pollution, mild reaction conditions, and easy promotion

Inactive Publication Date: 2018-11-06
DISHA PHARMA GRP +2
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Pseudomonas putida P. putida ATCC 33015 For production, but it is necessary to add aromatic hydrocarbons in the medium, such as toluene, xylene, etc., to activate the XylR protein, thereby regulating the Pu promoter of the upstream pathway of the endogenous plasmid, thereby inducing the expression of related enzymes, and this class Substances are often toxic and not environmentally friendly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant pseudomonas putida and application
  • Recombinant pseudomonas putida and application
  • Recombinant pseudomonas putida and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1. Construction of recombinant plasmids

[0037] Pseudomonas putida published on NCBI P. putida Endogenous plasmid pWWO sequence of ATCC 33105 (NCBI accession NC_003350.1). Amplify the gene clusters encoding xylene monooxygenase (XO), benzyl alcohol dehydrogenase (BZDH) and benzaldehyde dehydrogenase (BADH) on pWWO, with 5'ATGCGGGAAACAAAAGAGCAG 3' as the upstream primer, 5'TCAACCAATCCGGAGTACCGGCTTAAGC 3 'PCR amplification for the downstream primers to obtain the target gene. Replace the original T7 promoter of pRSFDuet-1 with the Tac promoter, because Pseudomonas putida cannot express T7 RNA polymerase and cannot recognize the T7 promoter. Using the transformed pRSFDuet-1 plasmid as a template, the 5' CGGTACTCCGGATTGGTTGA GCATAATGCTTAAGTCGAACAG3' is the upstream primer, 5' TGCTCTTTTGTTTCCCGCAT GCCCATGGTATATCTCCTTATT3' is the downstream primer (the underline is the 20bp homologous sequence that is homologous to the target gene cluster added to the vector ...

Embodiment 2

[0038] Example 2. Construction of recombinant Pseudomonas putida

[0039] The recombinant plasmid pRSFDuet-1-pWWO gene cluster constructed in Example 1 was transformed into a cloning host E. coli JM109, pick a single colony grown on the kanamycin-resistant LB plate, PCR amplification, agarose gel electrophoresis confirmation, pick the positive clone to extract the plasmid, and then perform sequencing, and transform the expression host with the correct sequence P. putida ATCC 33105, Construction of recombinant bacteria P. putida JN-18.

Embodiment 3

[0040] Example 3. Gene clusters encoding xylene monooxygenase (XO), benzyl alcohol dehydrogenase (BZDH) and benzaldehyde dehydrogenase (BADH) in P. putida Expression in JN-18

[0041] The recombinant Pseudomonas putida obtained in Example 2 P. putida Pick a single colony of JN-18 from the plate containing kanamycin antibiotic, inoculate it into LB seed medium containing kanamycin antibiotic, and cultivate it at 30 °C and 220 rpm for 12 h as the seed liquid. Inoculate 2% (v / v) inoculum into TB fermentation medium containing kanamycin antibiotic, and culture at 30°C and 220 rpm until OD 600 =0.6, add IPTG with a final concentration of 0.2 mM, induce at 28°C for 10 h, and collect the bacteria by centrifugation for whole-cell catalysis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to recombinant pseudomonas putida and application thereof to production of 5-methyl pyrazine-2-carboxylic acid, and belongs to the field of fermenting engineering. The recombinant pseudomonas putida JN-18 is characterized in that the collection number is CGMCC No. 15734; the collection unit is Common Microorganism Center of China Committee for Culture Collection of Microorganisms. The recombinant pseudomonas putida has the advantages that the over-expression of xylene monooxygenase, benzyl alcohol dehydrogenase and benzaldehyde dehydrogenase from self endogenous plasmid in P.putida ATCC 33015 is successfully realized; P.putida JN-18 is used for catalyzing 2,5-dimethylpyrazine to produce 5-methyl pyrazine-2-carboxylic acid in a whole-cell way.

Description

technical field [0001] The invention relates to a recombinant pseudomonas putida and a method for producing 5-methylpyrazine-2-carboxylic acid, belonging to the field of fermentation engineering. Background technique [0002] 5-Methylpyrazine-2-carboxylic acid (5-Methylpyrazine-2-carboxylic acid, MPCA) is an off-white solid crystal with the molecular formula C 6 h 6 N 2 o 2 , with a molecular weight of 138.12 and a melting point of 166-169°C, it is a nitrogen-containing heterocyclic compound with a carboxyl group and a methyl group. It has a pungent smell, and it will be slowly oxidized when exposed to the air, turning from a brown oily substance into a brown-black viscous solid, which needs to be stored in a vacuum seal. It is an important intermediate for the synthesis of drugs such as glipizide, acipimox and 5-methylpyrazine-2-carboxylate, and is used as a metal complex for the preparation of catalysts. [0003] [0004] The structural formula of 5-methylpyrazine-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/78C12P17/12C12R1/40
CPCC12N9/0006C12N9/0008C12N9/0073C12N15/78C12P17/12C12Y102/01028C12Y114/13008
Inventor李广生刘龙高永吉刘炳朋王永军其他发明人请求不公开姓名
OwnerDISHA PHARMA GRP