Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer and probe for identification of sturgeon based on quantitative real time polymerase chain reaction (PCR) as well as detection reagent kit and detection method thereof

A fluorescence quantitative and kit technology, applied in the field of molecular biology, can solve the problems of large influence of subjective judgment, poor repeatability, complicated operation, etc., and achieve the effects of avoiding aerosol pollution, short detection time and strong specificity

Inactive Publication Date: 2019-02-15
JINAN UNIVERSITY
View PDF12 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the identification of sturgeon, mainly relying on the traditional morphological identification method, but practitioners need to have strong professional background knowledge, which is greatly affected by subjective judgment and is prone to errors
The detection methods based on molecular biology mainly include microsatellite molecular markers, random primer amplification polymorphism, restriction length polymorphism, etc., but these methods have disadvantages such as time-consuming, complicated operation, poor repeatability, and large errors.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe for identification of sturgeon based on quantitative real time polymerase chain reaction (PCR) as well as detection reagent kit and detection method thereof
  • Primer and probe for identification of sturgeon based on quantitative real time polymerase chain reaction (PCR) as well as detection reagent kit and detection method thereof
  • Primer and probe for identification of sturgeon based on quantitative real time polymerase chain reaction (PCR) as well as detection reagent kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Establishment of a detection kit for rapid identification of sturgeon based on fluorescence quantitative PCR technology

[0033] A detection kit for rapid identification of sturgeon based on fluorescence quantitative PCR technology, including primer set, PCR MIX reaction solution, deionized water, positive control and negative control.

[0034] (1) Fluorescence quantitative PCR amplification primer design: The primer design was carried out with the sturgeon-specific conserved sequence as the target gene. The primer sequences are shown in Table 1.

[0035] Table 1 Primer sequence list

[0036] primer name

Primer sequence (5'-3')

FP

CTGCATACATTAAATTGTAC (SEQ ID NO: 1)

BP

GGTAGATGAAACATTCTG (SEQ ID NO: 2)

Probe

TAATCCCCATTAATTTCTAGCCACCA (SEQ ID NO: 3)

[0037] (2) Fluorescence quantitative PCR MIX reaction solution contains: 5U Taq enzyme, 2.5mM dNTPs, 25mM MgCl2, 2×PCRbuffer.

[0038] (3) The positive contro...

Embodiment 2

[0040] Example 2 Detection method for rapid identification of sturgeon based on fluorescence quantitative PCR technology

[0041] Utilize the test kit of embodiment 1 to detect the method for sturgeon, comprising the steps:

[0042] (1) Extraction of DNA from the sample to be tested;

[0043] (2) Fluorescence quantitative PCR reaction system: 25 μL reaction system contains 1 μL each of 10 μmol / L FP and BP primers, 0.5 μL 10 μmol / L probe, 12.5 μL PCR MIX reaction solution, 5 μL template, and make up to 25 μL with deionized water ; Set positive control and negative control; mix the prepared PCR tube, centrifuge, and place a fluorescent PCR instrument (such as ABI7500) for reaction.

[0044] (3) The reaction procedure was as follows: 95°C for 10 min; 95°C for 15 sec, 60°C for 60 sec, 45 cycles, and fluorescence signals were collected at the end of each cycle extension.

[0045] (4) Judgment of results: observe the amplification results of CT amplification by fluorescence quanti...

Embodiment 3

[0046] Example 3 Specificity Experiment

[0047] The samples came from an aquatic market in Guangzhou and a fresh food website, including blue grouper, sturgeon arowana, yellow croaker, perch, sturgeon, salmon, golden pomfret, Zhoushan pomfret, Wuhan grass carp, Alaska golden pomfret, and South American grey pomfret , Turbot, Malaysian sturgeon, East China Sea hairtail, mandarin fish, Wuhan mandarin fish, Russian saury, East China Sea pomfret, crucian carp and other 37 samples, all samples have been verified by sequencing method, the test results are shown in figure 1 . Judging from the detection in the figure, the solution of the present invention has good specificity.

[0048]In addition, using the method and the kit of the present invention to detect the actual samples, 435 samples of fish were selected from the inspection and quarantine departments and the inspection stations of the quality inspection department. All can detect correct results. The scheme of the present ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection primer and a probe for rapid identification of sturgeon based on quantitative real time polymerase chain reaction (PCR) as well as a detection reagent kit and a detection method which adopt the primer and the probe. A detection primer group comprises a forward primer FP, a backward primer BP and the probe; the detection reagent kit comprises a primer solution, aPCR mix reaction solution, deionized water, a negative control and a positive control; and the detection method comprises the following steps: the DNA of a sample to be examined is extracted; the quantitative PCR is utilized for rapidly identifying the DNA of the sample to be examined; and whether the sample to be examined is the sturgeon or not is judged by a real-time amplification curve. The invention has the advantages of high speed, sensitivity, specificity, easy operation, and the like, and is suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a primer and a probe for detecting sturgeon based on fluorescence quantitative PCR, a kit and a method thereof. Background technique [0002] Sturgeon (Acipenser), belonging to the class of bony fish, subclass of rayfin, and sturgeon, is an ancient fish with high scientific research, medicinal and ornamental value. Sturgeon is a high-protein, fatty fish, its skin can be made into high-quality special leather, fish eggs can be made into caviar, fish gallbladder can be used as medicine, fish meat, fish intestines and fish bones are all excellent delicacies. It is "the whole body is treasure". However, due to human factors affecting the living environment of sturgeon and overfishing and other factors, the number of wild sturgeon has dropped sharply. In order to seek high profits, many businesses in the processing, market circulation and other links, there are shoddy, indis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6851C12Q1/6888C12N15/11
CPCC12Q1/6851C12Q1/6888C12Q2531/113C12Q2563/107
Inventor 叶蕾曹炜伟陈洵白卫滨徐明芳常彦磊石磊
Owner JINAN UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More