Primer and probe for identification of sturgeon based on quantitative real time polymerase chain reaction (PCR) as well as detection reagent kit and detection method thereof
A fluorescence quantitative and kit technology, applied in the field of molecular biology, can solve the problems of large influence of subjective judgment, poor repeatability, complicated operation, etc., and achieve the effects of avoiding aerosol pollution, short detection time and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Establishment of a detection kit for rapid identification of sturgeon based on fluorescence quantitative PCR technology
[0033] A detection kit for rapid identification of sturgeon based on fluorescence quantitative PCR technology, including primer set, PCR MIX reaction solution, deionized water, positive control and negative control.
[0034] (1) Fluorescence quantitative PCR amplification primer design: The primer design was carried out with the sturgeon-specific conserved sequence as the target gene. The primer sequences are shown in Table 1.
[0035] Table 1 Primer sequence list
[0036] primer name
Primer sequence (5'-3')
FP
CTGCATACATTAAATTGTAC (SEQ ID NO: 1)
BP
GGTAGATGAAACATTCTG (SEQ ID NO: 2)
Probe
TAATCCCCATTAATTTCTAGCCACCA (SEQ ID NO: 3)
[0037] (2) Fluorescence quantitative PCR MIX reaction solution contains: 5U Taq enzyme, 2.5mM dNTPs, 25mM MgCl2, 2×PCRbuffer.
[0038] (3) The positive contro...
Embodiment 2
[0040] Example 2 Detection method for rapid identification of sturgeon based on fluorescence quantitative PCR technology
[0041] Utilize the test kit of embodiment 1 to detect the method for sturgeon, comprising the steps:
[0042] (1) Extraction of DNA from the sample to be tested;
[0043] (2) Fluorescence quantitative PCR reaction system: 25 μL reaction system contains 1 μL each of 10 μmol / L FP and BP primers, 0.5 μL 10 μmol / L probe, 12.5 μL PCR MIX reaction solution, 5 μL template, and make up to 25 μL with deionized water ; Set positive control and negative control; mix the prepared PCR tube, centrifuge, and place a fluorescent PCR instrument (such as ABI7500) for reaction.
[0044] (3) The reaction procedure was as follows: 95°C for 10 min; 95°C for 15 sec, 60°C for 60 sec, 45 cycles, and fluorescence signals were collected at the end of each cycle extension.
[0045] (4) Judgment of results: observe the amplification results of CT amplification by fluorescence quanti...
Embodiment 3
[0046] Example 3 Specificity Experiment
[0047] The samples came from an aquatic market in Guangzhou and a fresh food website, including blue grouper, sturgeon arowana, yellow croaker, perch, sturgeon, salmon, golden pomfret, Zhoushan pomfret, Wuhan grass carp, Alaska golden pomfret, and South American grey pomfret , Turbot, Malaysian sturgeon, East China Sea hairtail, mandarin fish, Wuhan mandarin fish, Russian saury, East China Sea pomfret, crucian carp and other 37 samples, all samples have been verified by sequencing method, the test results are shown in figure 1 . Judging from the detection in the figure, the solution of the present invention has good specificity.
[0048]In addition, using the method and the kit of the present invention to detect the actual samples, 435 samples of fish were selected from the inspection and quarantine departments and the inspection stations of the quality inspection department. All can detect correct results. The scheme of the present ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap