Unlock instant, AI-driven research and patent intelligence for your innovation.

Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof

A technology of microbead array chips and detection kits, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of long analysis period, low sensitivity, and large sample volume, and achieve independence from complex equipment , high sensitivity and simple operation

Active Publication Date: 2019-02-19
HUNAN INSTITUTE OF ENGINEERING
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] (1) There are certain defects in these detection methods in the prior art, such as: the need for expensive instruments and equipment, high false positives, high detection cost, long analysis cycle, cumbersome experimental process, etc., are only suitable for high-risk areas (such as China Hong Kong, Guangdong and other regions) carry out screening among people, and it is simply difficult for ordinary people in low-risk areas to afford a series of high costs brought about by testing;
[0007] (2) Due to the shortcomings of low sensitivity and large sample volume, the existing conventional technology is difficult to develop into a clinical detection technology, especially it is difficult to detect target DNA with extremely low concentration in blood samples
[0008] (3) It is difficult to solve the difficult problem that high-throughput and high-sensitivity properties are difficult to coexist under the condition of micro-sample in the field of micro-medicine analysis technology or the field of minimally invasive and non-invasive diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof
  • Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof
  • Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Prepare the detection kit according to the method described, the modified probes on the functionalized microspheres are as shown in the capture probes in Table 1, and the DNA probes for auxiliary basic structure DNA circularization are as shown in the circularization auxiliary probes in Table 1, The probes cross-linked with the aminated graphene quantum dots are shown in the signal probes in Table 1, and the loop-mediated isothermal amplification primers are shown in F3, B3, FIP, and BIP in Table 1, and the prepared Epstein-Barr virus DNA detection Reagent test kit.

[0071] Table 1 DNA sequence

[0072]

[0073]

[0074] BIP ATCACCTCTGATTCTGGCCCCCGCCGGGATGCTAATGTTCA loop-mediated isothermal amplification primers comprising B1C and B2SEQ ID NO:7.

[0075] The sequence of the basic structure of LAMP is SEQ ID NO: 8;

[0076] AGGGGCGGGTGGATTATCTGTTTGGGGGTGCAAGTTTTGGCTGGCCTGGGGGCCGTGGGGTCAACAGATAATCCACCCGCCCCTGGCGTGGAAGTTAATGTCCAGAGATCACCTCTGATTCTGGCCCCCAACGCCTCTGG...

Embodiment 2

[0080] (1) Design and preparation of microfluidic chip and construction of detection chip

[0081] Firstly, the designed chip structure pattern is drawn by drawing software (CorelDRAW 9.0), and printed on Kodak film with a resolution of 2400dpi to prepare the photomask of the chip; then the pattern of the photomask is exposed by ultraviolet light Transfer to the PCB board covered with photoresist, and prepare the positive template of the chip on the exposed PCB board by chemical etching method; accurately weigh 12g polydimethylsiloxane prepolymer and 1.2g curing agent, stir Make it fully mixed for 5 minutes, remove the air bubbles in vacuum, and then spread it on the prepared chip positive template (thickness is about 1mm). The dimethylsiloxane (PDMS) sheet was peeled off from the positive template.

[0082] Such as figure 2 As shown, the schematic diagram of the structure of the microfluidic microbead array chip provided by the embodiment of the present invention and the s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biomolecule detection, and discloses a circulating nucleic acid detection kit based on a microfluidic microsphere array chip and an application method thereof. The circulating nucleic acid detection kit based on the microfluidic microsphere array chip comprises a microfluidic detection chip for capturing probe functionalized microspheres, four LAMP primers and LAMP amplification reagents, a LAMP basic structure cyclization reagent and a cyclization auxiliary probe, a rolling ring amplification reagent, and a signal probe modified graphene quantumdot. The method is simple in operation and extremely high in sensitivity, and the early diagnosis of nasopharyngeal carcinoma can be achieved through detection of Epstein-Barr virus in blood. According to the circulating nucleic acid detection kit based on the microfluidic microsphere array chip and the application method thereof, the microscale and high-sensitivity detection characteristics of the micro-fluidic dynamic microarray chip, the multi-signal amplification (including loop-mediated isothermal amplification and rolling loop amplification) of the high-sensitivity target and the functional graphene quantum dot fluorescence signal amplification are integrated for the first time, and 10 mol / L Epstein-Barr virus DNA can be detected.

Description

technical field [0001] The invention belongs to the technical field of biomolecular detection, and in particular relates to a microfluidic microbead array chip-based circulating nucleic acid detection kit and an application method. Background technique [0002] At present, the existing technologies commonly used in the industry are as follows: [0003] Circulating tumor nucleic acid (ctDNA) has a low concentration in blood and there is a high level of interference from normal circulating DNA, so it is a very challenging task to establish a rapid and highly sensitive ctDNA detection method. In the past decade, many analytical techniques with great development potential have been proposed for the detection of ctDNA, especially from 2012 to the present, some new concepts and testing methods have been introduced into this field. For example: technology systems based on quantitative PCR (such as Amplification RefractoryMutation System (ARMS), SNPase-ARMS qPCR, mutant-enriched PC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6886C12Q1/6837C12Q1/6844
CPCC12Q1/6837C12Q1/6844C12Q1/6886C12Q1/705C12Q2563/107C12Q2531/119
Inventor 张何周宁涛雷志翔傅昕杨梅
Owner HUNAN INSTITUTE OF ENGINEERING
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More