Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof

A technology of microbead array chips and detection kits, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of long analysis period, low sensitivity, and large sample volume, and achieve independence from complex equipment , high sensitivity and simple operation

Active Publication Date: 2019-02-19
HUNAN INSTITUTE OF ENGINEERING
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] (1) There are certain defects in these detection methods in the prior art, such as: the need for expensive instruments and equipment, high false positives, high detection cost, long analysis cycle, cumbersome experimental process, etc., are only suitable for high-risk areas (such as China Hong Kong, Guangdong and other regions) carry out screening among people, and it is simply difficult for ordinary people in low-risk areas to afford a series of high costs brought about by testing;
[0007] (2) Due to the shortcomin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof
  • Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof
  • Circulating nucleic acid detection kit based on microfluidic microbead array chip and application method thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0069] Example 1;

[0070] The detection kit was prepared according to the method. The modified probes on the functionalized microspheres are shown in the capture probes in Table 1, and the DNA probes that assist in the circularization of basic structure DNA are shown in the circularization auxiliary probes in Table 1. The probes cross-linked with the aminated graphene quantum dots are shown in the signal probes in Table 1, and the loop-mediated isothermal amplification primers are shown in F3, B3, FIP, BIP in Table 1. The prepared EB virus DNA detection Reagent test kit.

[0071] Table 1 DNA sequence

[0072]

[0073]

[0074] The BIP ATCACCTCTGATTCTGGCCCCCGCCGGGATGCTAATGTTCA loop-mediated isothermal amplification primers include B1C and B2 SEQ ID NO: 7.

[0075] The LAMP basic structure sequence is SEQ ID NO: 8;

[0076] AGGGGCGGGTGGATTATCTGTTTGGGGGTGCAAGTTTTGGCTGGCCTGGGGGCCGTGGGGTCAACAGATAATCCACCCGCCCCTGGCGTGGAAGTTAATGTCCAGAGATCACCTCTGATTCTGGCCCCCAACGCCTCTGGCATGTTTGAGTCCCGCTGGCTGAA...

Example Embodiment

[0079] Example 2;

[0080] (1) Design and preparation of microfluidic chip and construction of detection chip

[0081] First, draw the designed chip structure pattern through the drawing software (CorelDRAW 9.0), and print it on Kodak film with a resolution of 2400dpi to prepare the photomask of the chip; then the pattern of the photomask is exposed to ultraviolet light Transfer to the PCB board covered with photoresist, and prepare the positive template of the chip on the exposed PCB board by chemical etching method; accurately weigh 12g polydimethylsiloxane precursor and 1.2g curing agent, stir Mix well for 5 minutes and remove the bubbles in a vacuum, then lay it flat on the prepared chip positive template (about 1mm thick). After the bubbles are removed, put it into an oven for 3 hours at 65°C for polymerization. After curing, take it out. Dimethylsiloxane (PDMS) film base is peeled off from the positive template.

[0082] Such as figure 2 As shown, the schematic diagram of th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biomolecule detection, and discloses a circulating nucleic acid detection kit based on a microfluidic microsphere array chip and an application method thereof. The circulating nucleic acid detection kit based on the microfluidic microsphere array chip comprises a microfluidic detection chip for capturing probe functionalized microspheres, four LAMP primers and LAMP amplification reagents, a LAMP basic structure cyclization reagent and a cyclization auxiliary probe, a rolling ring amplification reagent, and a signal probe modified graphene quantumdot. The method is simple in operation and extremely high in sensitivity, and the early diagnosis of nasopharyngeal carcinoma can be achieved through detection of Epstein-Barr virus in blood. According to the circulating nucleic acid detection kit based on the microfluidic microsphere array chip and the application method thereof, the microscale and high-sensitivity detection characteristics of the micro-fluidic dynamic microarray chip, the multi-signal amplification (including loop-mediated isothermal amplification and rolling loop amplification) of the high-sensitivity target and the functional graphene quantum dot fluorescence signal amplification are integrated for the first time, and 10 mol/L Epstein-Barr virus DNA can be detected.

Description

technical field [0001] The invention belongs to the technical field of biomolecular detection, and in particular relates to a microfluidic microbead array chip-based circulating nucleic acid detection kit and an application method. Background technique [0002] At present, the existing technologies commonly used in the industry are as follows: [0003] Circulating tumor nucleic acid (ctDNA) has a low concentration in blood and there is a high level of interference from normal circulating DNA, so it is a very challenging task to establish a rapid and highly sensitive ctDNA detection method. In the past decade, many analytical techniques with great development potential have been proposed for the detection of ctDNA, especially from 2012 to the present, some new concepts and testing methods have been introduced into this field. For example: technology systems based on quantitative PCR (such as Amplification RefractoryMutation System (ARMS), SNPase-ARMS qPCR, mutant-enriched PC...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6886C12Q1/6837C12Q1/6844
CPCC12Q1/6837C12Q1/6844C12Q1/6886C12Q1/705C12Q2563/107C12Q2531/119
Inventor 张何周宁涛雷志翔傅昕杨梅
Owner HUNAN INSTITUTE OF ENGINEERING
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap