Unlock instant, AI-driven research and patent intelligence for your innovation.

A specific labeling method for enterotoxigenic Escherichia coli

A technology of Escherichia coli and labeling methods, applied in the field of genetic engineering, can solve problems such as poor stability, lack of versatility, and low strain specificity, and achieve high detection sensitivity, high editing efficiency, and environmental friendliness

Active Publication Date: 2020-08-25
SOUTH CENTRAL UNIVERSITY FOR NATIONALITIES
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It was found that the spontaneous blue-green and other short-wave fluorescence of animal intestines is relatively strong, which greatly interferes with the real-time imaging and monitoring of exogenous pathogenic bacteria
In addition, when this reporter gene is applied to the animal challenge model, the fluorescent plasmid is easy to lose, and a certain resistance pressure needs to be maintained to maintain the stability of the plasmid, so this challenge model is difficult to reflect the foreign strains in the stomach of animals. Intestinal reality
These models lack versatility, the specificity of the labeled strains is not strong, the stability is poor, and high-sensitivity detection cannot be achieved in actual detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A specific labeling method for enterotoxigenic Escherichia coli
  • A specific labeling method for enterotoxigenic Escherichia coli
  • A specific labeling method for enterotoxigenic Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Selection of Enterotoxigenic Escherichia coli Strains

[0043] The Escherichia coli strains capable of causing intestinal pathogenicity were detected, the Escherichia coli genome DNA was extracted, and the genome DNA was identified by 0.8% agarose electrophoresis. According to the enterotoxin-producing gene sequence published on NCBI, a pair of primers were synthesized, the toxic gene was detected by PCR, and the PCR product was identified by 2% agarose gel electrophoresis, such as figure 1As shown, the size is 219bp;

[0044] ST-F: 5'-CCATGGCATCTACACAATCAA-3' (SEQ ID NO: 4);

[0045] ST-R: 5'-CTCGAGTTAGCATCCTTTTGCT-3' (SEQ ID NO: 5).

[0046] figure 1 The results showed that the Escherichia coli strain capable of causing enteropathogenicity was enterotoxigenic Escherichia coli.

Embodiment 2

[0047] Example 2: Selection and validation of pseudogene loci

[0048] Using the Escherichia coli K12 gene sequence as a reference, 6 pseudogene positions that can be inserted into foreign genes were predicted by using ABCpred through bioinformatics analysis, namely yaiT, yai X, yge O, yheO, wbb L and ykg A. PCR primers were designed according to the above pseudogene loci, and the enterotoxigenic Escherichia coli genome in Example 1 was used as a template for detection.

[0049] According to the yheO gene sequence (GenBank accession number NC_000913.3) published in Genbank, design primers yheO-F, yheO-R, with enterotoxic E. coli genomic DNA in Example 1 as template, complete yheO gene PCR amplification in ETEC Detection, the size of the amplified target band is 814bp, and the size of the PCR amplified band is in line with expectations, such as figure 2 , the PCR amplification product is sequenced, and the yheO sequence is shown in SEQ ID NO:1.

[0050] yheO-F: GTAGAAGCCGGTA...

Embodiment 3

[0053] Example 3: Designing sgRNA target primers and constructing gene editing vectors

[0054] 1. Target sequence design

[0055] Primers were designed according to the principles of Cas9 target design: G at the 5' end, PAM sequence (NGG) at the 3' end, and a guide sequence yheO-gRNA: ATATAATTAGTGCTGGAAAGCGG (SEQ ID NO: 8).

[0056] 2. PCR amplified sgRNA fragment and double enzyme digestion ligation of plasmid

[0057] Using the pTarget plasmid as a template, design primers P1, P2, and P3, carry out PCR amplification through primers P1 and P3, obtain PCR products identified by 2% agarose gel electrophoresis, and purify and reclaim it with DNA Fragment Purification Kit (sequence such as SEQ ID NO:20), and then use the recovered PCR product as a template, carry out PCR through primers P2 and P3, amplify to obtain a linearized PCR product containing the target sequence, and purify and recover the same (sequence such as SEQ ID NO:21) .

[0058] P1: ATATAATTAGTGCTGGAAAGgttttag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific marking method for enterotoxigenic escherichia coli. The method includes taking a red fluorescent protein gene as a reporter gene, and utilizing a CRISPR / Cas9 system to knock a RFP gene into a genome of the enterotoxigenic escherichia coli at a fixed point. The specifically-marked enterotoxigenic escherichia coli constructed by the method can realize the specific identification and monitoring of pathogenic escherichia coli, and provide a methodological basis for studying the infection path and pathogenic mechanism of the enterotoxigenic escherichia coli in vivo.

Description

technical field [0001] The present invention relates to the technical field of genetic engineering, in particular to a fluorescent labeling of pathogenic bacteria, more specifically to a specific labeling method for enterotoxic E. A method for establishing ETEC-specific markers in E. coli. Background technique [0002] Enterotoxigenic Escherichia coli (ETEC) is an important pathogen that causes diarrhea in humans and young animals, with high morbidity and mortality, and is one of the current research hotspots. Adhesins are closely related to enterotoxin production. [0003] At present, a challenge model of enterotoxigenic Escherichia coli ETEC is constructed at home and abroad, and the pathogenic bacteria are marked to realize real-time monitoring, and can directly observe biological processes such as its distribution, colonization, and infection in animals. For example, Corr et al. (2007) used lux gene-marked Listeria monocytogenes as a challenge model to clarify that the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/65C12N15/70C12N1/21C12R1/19
CPCC07K14/43595C12N15/65C12N15/70C12N2800/80C12N2810/10
Inventor 郭小华苏雅婷梁晓声张莉
Owner SOUTH CENTRAL UNIVERSITY FOR NATIONALITIES