Unlock instant, AI-driven research and patent intelligence for your innovation.

Umbilical cord mesenchymal stem cells silenced by mir338 gene and its preparation method and application

A technology of mesenchymal stem cells and gene silencing, applied in the fields of genetic engineering and biomedical engineering, can solve problems such as complex pathophysiological mechanisms and unclear understanding, and achieve good therapeutic effects, good clinical application prospects, and accelerated cell proliferation.

Active Publication Date: 2022-03-15
SOUTHERN MEDICAL UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the complex pathophysiological mechanism of ischemic stroke, the understanding of the specific regulatory mechanism in ischemic brain injury is still not very clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Umbilical cord mesenchymal stem cells silenced by mir338 gene and its preparation method and application
  • Umbilical cord mesenchymal stem cells silenced by mir338 gene and its preparation method and application
  • Umbilical cord mesenchymal stem cells silenced by mir338 gene and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction and identification of lentiviral particles overexpressing mir-338

[0036] 1. Obtaining the target plasmid

[0037] The lentiviral system vector pLVX-DsRed-Monomer-N1 was used, and the cDNA sequence of the target gene was ligated to the vector, and the restriction site was AsuII / BamHI, and the target plasmid mir-338p-pLVX-DsRed-Monomer was obtained by gene synthesis -N1, the sequence of the recombinant plasmid mir-338p-pLVX-DsRed-Monomer-N1 is shown in SEQ ID NO:1.

[0038] SEQ ID NO: 1

[0039]TGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGC AGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGGTAGA AGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGG AGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGATATCGAGCTTGCTACA AGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGC TGCTTTTTGCCTGTACTGG...

Embodiment 2

[0045] Example 2 Transfection of umbilical cord mesenchymal stem cells with mir-338 overexpressing lentivirus

[0046] 1. Isolation, culture and identification of human umbilical cord mesenchymal stem cells

[0047] HUMSCs were cultured in DMEM low-glucose medium containing 10% FBS, and the cells were cultured in a 37°C, 5% carbon dioxide incubator. The cells were observed with an inverted microscope once a day, and the culture medium was changed every 2 to 4 days. When the cells in the culture flask grow to 80% to 95% confluence, perform cell passage or collect cells for plating. Discard the old culture medium, add 2 mL of 0.25% trypsin digestion solution, after the cells become round and float, add 4 mL of culture medium to terminate the digestion, then transfer to a sterile centrifuge tube, centrifuge at 1000 r / min for 4 min, discard the supernatant, Transfer to a new sterile culture bottle at a ratio of 1:4 to 1:6.

[0048] Discard the old medium in the culture flask, w...

Embodiment 3

[0059] Example 3 Construction and identification of silent mir-338 lentiviral particles

[0060] 1. Target gene acquisition

[0061] The lentivirus system vector LentiCRISPR v2 was used to connect the cDNA sequence of the target gene to the vector. The restriction enzyme cut site: BamHI / Apa I was used to obtain the target plasmid LentiCRISPR v2-mir338 by gene synthesis. The sequence of the recombinant plasmid LentiCRISPR v2-mir338 As shown in SEQ ID NO:2.

[0062] SEQ ID NO: 2

[0063]TGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCA ATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCG TGTACGGTGGGAGGTCTATATAAGCAGCGCGTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGG CTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGT AACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGAAAGGGAAACC AGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mir338 gene silenced umbilical cord mesenchymal stem cell, a preparation method and application thereof. The preparation method comprises the following steps: S1. Inserting the target gene into the lentiviral system vector to construct the LentiCRISPR v2-mir338 recombinant plasmid; S2. Co-transfecting the host cell with the LentiCRISPR v2-mir338 recombinant plasmid obtained in S1 and the packaging plasmid to prepare Lentiviral particles; S3. The lentiviral particles obtained in S2 are transfected into HUMSCs to obtain genetically engineered HUMSCs. After HUMSCs silenced the expression of mir338 gene, the cell proliferation speed was accelerated, and the injection of HUMSCs into brain-injured minipigs had a good therapeutic effect on brain injury.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and biomedical engineering, in particular to a mir338 gene-silenced umbilical cord mesenchymal stem cell and a preparation method and application thereof. Background technique [0002] Ischemic cerebrovascular disease (ICVD) refers to the disease, necrosis or transient loss of function of local brain tissue, including nerve cells, glial cells and connecting fibers, due to blood supply disorders. At present, ischemic cerebrovascular disease accounts for about 80% of all cerebrovascular diseases, and cerebral ischemic disease has the characteristics of high incidence, high mortality, high recurrence rate and high disability rate. my country is a country with a high incidence of stroke, with 2 million new strokes and 2.5 million stroke deaths each year, with an annual growth rate of 8.7%. Clinically, ischemic cerebrovascular disease caused by middle cerebral artery occlusion accounts for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867C12N5/10A61K35/28A61P25/00
CPCA61P25/00A61K35/28C12N5/0668C12N15/86C12N2740/15043C12N2510/00C12N2800/107
Inventor 田雨光岳敏
Owner SOUTHERN MEDICAL UNIVERSITY